Pretty lively<\/li>\n<\/ul>\n",Insecta,,,,,,"","",,,,,
"",36.1444896000,-86.8011462000,07/19/2021,"",Insecta,,,,,,"","",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/20210719_111354-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/20210719_111338-scaled.jpg,",36.1444896,-86.8011462,07/19/2021,"",Hexapoda,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/20210719_105547-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/20210719_105543-scaled.jpg,",39.4255240598,-77.4212635020,07/19/2021,"Released a smelly yellow defe se mechanism. Has a strong likelihood of having Wolbachia.<\/p>\n",Hexapoda,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-20-scaled.jpg,",41.5350371000,-72.0846033000,07/07/2021,"
A park, near a wet and shade covered area.<\/p>\n",Formicidae,Edwards Buffer,Abdomen,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/D4A69279-BB86-4002-9D93-78E8884BA05B-scaled.jpeg,","
Used abdomen<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-22-scaled.jpg,",41.5242649,-72.0759105,07/07/2021,"
Arthropod was found in mulch and dirt under a tree. It has a dark back with a tan belly. The legs are red.<\/p>\n",Diplopoda,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-33-scaled.jpg,","
I used the whole arthropod and it is located in the seventh well.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/50B8B1B0-87B8-4984-890C-4F1E2BE83A85-scaled.jpeg,",41.5368482747,-72.0825521808,07/06/2021,"
Found on stairs outside in the shade.<\/p>\n",Arachnida,Edwards Buffer,Abdomen,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/1C6C75AB-ED39-4D3E-A446-E30C2BA52D0B-scaled.jpeg,","
Used the abdomen<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-24-scaled.jpg,",41.5369465971,-72.0830722324,07/07/2021,"
Tiny ant crawling through dirt under a tree.<\/p>\n",Formicidae,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"","
I used the entire arthropod pod. It is loacated in the fourth well.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/A4D9A9F4-8D67-4B69-A776-C5D14C66F095-scaled.jpeg,",41.5532772000,-72.0823688000,07/06/2021,"
Found in the log of a tree.<\/p>\n",Insecta,Edwards Buffer,,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/C859020C-BBA6-446E-A105-4E7ED49815D4-scaled.jpeg,","
Used the abdomen.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/8969625C-CB78-4F12-87A2-20451B8EAA5B-scaled.jpeg,",41.5369561875,-72.0830260778,07/06/2021,"
I found it in a field of grass while standing up. It was also near a stream, it was also 88 degrees, we were near a shaded tree when we caught it. The grass wasn\u2019t tall, the legs are long and it goes skinnier as it goes down. There are long lines on the body, the skin texture is different than others. The skin texture is is black on top and on the bottom whiter than the top.<\/p>\n",Phalangopsidae,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/C9971BAD-CD2F-41A5-9A6A-CF686EDA5775-scaled.jpeg,","
I used the whole bug and put it in a tube and mashed it up.<\/p>\n",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-4-scaled.jpg,",41.5242649000,-72.0759105000,07/06/2021,"
This tiny spider has eight legs and lives on the bark of trees.<\/p>\n",Araneidae,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-33-scaled.jpg,","
I used the entire bug. It is located in the second well.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/E723CCF6-7C3C-4567-95C0-A541A3637AC8-scaled.jpeg,",41.5252223262,-72.0762100529,07/07/2021,"
This ant was very fierce, it bit on my glove and held on very fierce, I tried pulling him and resulted in breaking the connection between his head and body, the ant still held on, I was very surprised, this any can still bit very hard even if it\u2019s body got separated from it\u2019s head! I had to smush it\u2019s head to get him to not bite. This ant is 1.2cm long and it has 4 sections on the last part of the body. Very large and fierce, found in a park, found in the part where there is all soil and behind the ant was a wall of leafs\/bushes. Found in this park next to the Mohegan park.<\/p>\n",Camponotus,Edwards Buffer,Abdomen,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/1E5168E5-36E0-4D90-BC8D-2F695FF72BFC-scaled.jpeg,","
This ant is the 3rd hole, bottom to top. This ant was very big so I cut it\u2019s abdomen off and massed it. This ant was the same specials as my other experiment but I did this ant first and had some problems.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/315670E0-8782-40EE-B8D0-520F48374D70-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/8BF013EC-0650-4787-A389-101BCBB2C7E6-scaled.jpeg,",41.5369571354,-72.0830269302,07/07/2021,"
Found with the fierce ant. I thought the 2 ants were different cause of the size, found with the fierce ant, a park with grass but found in the part with only soil and dead leafs, behind it is a wall of leafs\/bushes. I think this ant is an ant for collecting while the fierce ant is for protecting. This ant is 0.7cm long and has 2 sections on the last part of the body. Found in this park near the Mohegan park.<\/p>\n",Camponotus,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/DB810984-5906-4741-9723-6F9BD949F3B7-scaled.jpeg,","
this ant was the 5th hole bottom to top, there was nothing. I used the whole ants body and didn\u2019t have that much problems, the steps was going smoothly, although maybe encountering some tiny problems, the whole process was smooth.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/7B1F90C9-37B5-4028-9958-4E81A138C85A-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/781BCB97-7260-4F8E-B6D3-43232250CE44-scaled.jpeg,",41.5369641848,-72.0830365943,07/07/2021,"
This earwig is 2cm long, I found it under a tree, in the soil. I found this in a park with a lot of grass and soil, a park near the Mohegan park. The earwig has 2 white things on his front, the white thing was near the 2nd leg, in between of the 2nd leg, on the shells. Green legs and looks exactly like a European earwig. The tail is in a circular shape. Found in this park near the Mohegan park.<\/p>\n",Forficula auricularia,Edwards Buffer,Abdomen,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/9BA7E19C-4C68-47B7-AE64-41040428F768-scaled.jpeg,","
The top one was me, the bottom one was my partner, the one on the right was mine. I did it from the left to right so the one in the picture, on the bottom was my shape standard, the 2nd one was my control, the 3nd one was the Earwig.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-23-scaled.jpg,",41.5369417362,-72.0830729974,07/07/2021,"
It is a yellow butterfly with brown antennas And brown eyes. It has six legs and a fuzzy body. It was found flying by a river In the shade.<\/p>\n",Lepidoptera,Edwards Buffer,Abdomen,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/4EB0F094-36D6-46A1-A09E-96790D576FDA.jpeg,","
The butterfly is in the seventh well. The butterfly\u2019s wings were to big to fit into the tube so I only used the abdomen.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-8-scaled.jpg,",41.5242649000,-72.0759105000,07/07/2021,"
Arthropod was found in an shaded field next to a river. The It has an hard, shiny exoskeleton, and a black stripe down the dorsal side of its back.<\/p>\n",Philoscia muscorum,Edwards Buffer,Abdomen,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-33-scaled.jpg,","
I used the abdomen of this bug, because it had a hard shell. This bug is loacated in the sixth well.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/AAA01958-00E9-41F9-AF40-27376FC0BFE2-scaled.jpeg,",41.5242649000,-72.0759105000,07/07/2021,"
Caught on notebook on grass. bark like shell. very small.<\/p>\n",Curculionidae,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/472A3ECE-7363-4A39-8EBE-6A429D6F5A77-scaled.jpeg,","
The entire bug was mashed.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/D322D896-AA0C-47F7-8B78-E079B3596825-scaled.jpeg,",,,07/07/2021,"
Found on tree in a grass area black back really small two antenna six legs legs light brown bottom is dark brown with with lines black head<\/p>\n",,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/9D2312E0-1931-45A4-A959-5B76E0CFDF3B-scaled.jpeg,","
I put it in many machines<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-17-scaled.jpg,",41.5370779698,-72.0829856432,07/07/2021,"
It has a brown head, black body, and brown the rest of the way down. It has pinchers at the rear end and six legs. Two antennas and has a shiny casing. It was found in a leaf pile by a river.<\/p>\n",Dermaptera,Edwards Buffer,Abdomen,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/3B474E79-B9C0-4EE8-9FCE-6E7B5174D035.jpeg,","
The ear wig is in well six. I used the abdomen because the rest of the body wasn\u2019t necessary.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/9CF99C32-F6C7-42F2-B319-9ED210A8883A.jpeg,",41.5272093319,-72.0759457777,07/06/2021,"
The grub is tan with a orange head and black mouth. \u00a0The grub has six legs that are all located in the beginning of the body. \u00a0The bug has a shiny coat over him.<\/p>\n",Phyllophaga,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-33-scaled.jpg,","
I used the entire arthropod. It is located in the fifth well.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-10-scaled.jpg,",41.5369890018,-72.0830558506,07/07/2021,"
The spider has a black body with yellow legs. The size is less than half an inch. It was found by a tree in a park. It was walking around in the dirt.<\/p>\n",Araneae,DNeasy (Qiagen),Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/6AB3E09C-D576-4E4E-AA75-CE7D51A76DF5.jpeg,","
The spider DNA is in the fifth well. The spider is very small so using the whole body was fine.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/A7AF9C09-4C5C-44A4-9FBD-EFEB36284271-scaled.jpeg,",,,,"
All light brown with black head has wings has white spots on the wings one black spot on end of wing<\/p>\n",,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/9D2312E0-1931-45A4-A959-5B76E0CFDF3B-scaled.jpeg,","
I put it in many machines<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-25-scaled.jpg,",41.5242649000,-72.0759105000,07/06/2021,"
Found in shaded area of leaf litter, 8 mm, black in color, round thorax<\/p>\n",Formicidae,Edwards Buffer,Abdomen,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/E15BCC72-EA57-496C-9CF5-45B62706AAC3-scaled.jpeg,","
Used abdomen of carpenter ant.<\/p>\n",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-3-scaled.jpg,",41.5370451176,-72.0830173938,07/06/2021,"
Black ant with reddish antennas, has six legs.<\/p>\n",Formicidae,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/4AFC8955-206A-4107-99E7-F58F69AB1EDD.jpeg,","
It is in the third well. I used the whole body because the ant was no bigger than a grain of rice.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-31-scaled.jpg,",36.1444896000,-86.8011462000,07/07/2021,"
Found being carried by ant<\/p>\n",Insecta,Edwards Buffer,Abdomen,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/97A8C4A3-F2E7-45F8-8C59-963DE1F33C79-scaled.jpeg,","
We used the abdomen of the arthropod.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/F92843AB-045C-4C71-A735-E2EF0116FCBF-scaled.jpeg,",41.5242649,-72.0759105,07/07/2021,"
Near a stream. Caught on grass. Long<\/p>\n",Euborellia annulipes,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/47E2F29D-E7DE-433B-BCFE-40573A3EC9CA-scaled.jpeg,","
I mashed the entire bug<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-19-scaled.jpg,",42.531184,-75.5235149,07/07/2021,"
Very skinny and brown with skinny iridescent wings. Looks like a dragonfly. Caught in uncut grass near a stream<\/p>\n",Coenagrionidae,Edwards Buffer,Abdomen,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-34-scaled.jpg,","
I cut off a piece of the abdomen and used that.<\/p>\n",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-18-scaled.jpg,",41.5242649000,-72.0759105000,07/06/2021,"
Segmented, oval body, long antennae, 6 legs, brown in color, collected in shaded area in leaf litter.<\/p>\n",Cryptocercus,Edwards Buffer,Abdomen,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/E15BCC72-EA57-496C-9CF5-45B62706AAC3-scaled.jpeg,","
Used abdomen of wood roach. In 3rd well.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/C4280651-1B1B-4E53-9BE5-711487DE4CA7-scaled.jpeg,",,,,"
Found on tree has black eyes brown with white spots and has orange legs<\/p>\n",,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/9D2312E0-1931-45A4-A959-5B76E0CFDF3B-scaled.jpeg,","
I put it in many machines<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-scaled.jpg,",41.5369059308,-72.0832532703,07/06/2021,"
Has a black face, white butt, grey scale like skin, six legs, and an orange bump above its head.<\/p>\n",Phyllophaga,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/D96B4B6C-28EA-43F1-BDB4-E26865BEF636.jpeg,","
The bug is in the fourth well. I extracted the DNA by crushing the whole bug in the tube.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/DBA1BB06-717B-41DA-B779-19330CA712DA-scaled.jpeg,",41.5532772000,-72.0823688000,07/06/2021,"
Very Small ant found under log legs red and the rest is black has five legs one antenna is longer then the other tip of antenna is a light red tip of the legs is light red the back half is blacker then the head and body<\/p>\n",Hymenoptera,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/9D2312E0-1931-45A4-A959-5B76E0CFDF3B-scaled.jpeg,","
I put it though many machines<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-26-scaled.jpg,",41.5370150261,-72.0830107187,07/07/2021,"
Found in leaf litter near river.<\/p>\n",Insecta,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-33-scaled.jpg,","
This bug is in the third well. I used the entire bug because it was small then a grain of rice.<\/p>\n",No,,,,
"",33.4117836105,-111.9017364601,05/25/2021,"
The scorpions were collected on and around a backyard wall using a black light after dark. The stingers were removed for safety.<\/p>\n",Scorpiones,DNeasy (Qiagen),Abdomen,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/Untitled-presentation.jpg,","
The scorpions were stored in a freezer for about 2 weeks until extraction.<\/p>\n
DNA Extraction: The DNA was extracted from the abdomen. All of the Dneasy (Qiagen) protocols were followed. The extraction took one day to complete.<\/p>\n
PCR: Mini One Taq polymerase was used.<\/p>\n
Gel Electrophoresis: Mini PCR was used. All of the lanes worked well except for Lane 2.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/5A54A7F8-485F-4FE7-B011-D8D953994B77-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/74B38A9D-7BD8-4CEE-93B4-1E40791B21F0-scaled.jpeg,",39.42198767529949,-77.42074471710104,07/12/2021,"
![\"\"](\"https:\/\/wolbachiaprojectdb.org\/wp-content\/uploads\/2021\/07\/5A54A7F8-485F-4FE7-B011-D8D953994B77-225x300.jpeg\")
![\"\"](\"https:\/\/wolbachiaprojectdb.org\/wp-content\/uploads\/2021\/07\/74B38A9D-7BD8-4CEE-93B4-1E40791B21F0-225x300.jpeg\")
<\/p>\n",Hexapoda,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-5-scaled.jpg,",41.53696371487127,-72.08303840664567,07/06/2021,"
A maggot that was caught in the woods near NFA, in a rotten log in the ground.<\/p>\n",Phyllophaga,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/CFEA3050-B015-467B-97A8-FBB68AB49C5C-scaled.jpeg,",36.1444896000,-86.8011462000,07/06/2021,"",Insecta,,,,,,"","
A moth caught in the wild.
\nwas in the woods and by a field of ferns
\ntan colored and has no markings on its abdomen<\/p>\n",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image-1-scaled.jpg,",41.53696371487127,-72.08303840664567,07/06/2021,"
It was caught in the woods, under a rock with a bunch of other ants and eggs.<\/p>\n",Formicidae,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/20210707_091918-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/20210707_092214-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/20210707_092204-scaled.jpg,",41.5532772000,-72.0823688000,07/07/2021,"
small round brown bug,beetle, clear under wings,approximately 1 centimeter long.<\/em><\/p>\n",Serica,,,,,,"","",,,,,
"",37.0870821,-76.4730122,03/03/2021,"This ant was caught in a backyard. It took a while because I was trying to not destroy the arthropod. In addition, under the when microscope, the ant was a dark brown color and its legs were weirdly bent.<\/p>\n",Hymenoptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/5C97CC9C-C77B-416B-B028-7431A2C83B1B.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/8F1C645F-83AD-4291-BC36-425046489A0A.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/8693B08A-2A4E-4116-B186-F964E24FF08B.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/F28FE488-2D4C-4E0A-993B-FB5559765E06.png,","
During my experiment, much of the lysis buffer spilled out onto the sides. In addition, the pellet was disturbed twice. The first time, I did the correct procedure and repeated the required steps. The second time, due to management, I was not able to and continued the experiment. My pellet was barely visible to the human eye and could only be seen when held up to the light.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/C1209CEB-51B5-4F38-9885-83561BDCD0A0-scaled.jpeg,",37.2707022000,-76.7074571000,05/09/2021,"
Black color, has legs, no wings<\/p>\n",Coleoptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/0228E37F-BD55-4DC3-B7DB-5F7B6DDBEF27.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/A71EF897-EA3C-4650-B63C-FB00EDF63CC9.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/C7727B63-D8F7-4803-9811-320BA9CF9C76.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/10F324C3-D0EA-4196-B4BB-E60F065E28D1.jpeg,","
My lab went pretty well. My pellet had a very pale color and it was a small amount. I had no mess ups In my lab but I wasn\u2019t there for the day they found the wolbachia.<\/p>\n",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/EDAB847E-F98E-4BAF-9EE3-313AC1312E69-scaled.jpeg,",37.0870821000,-76.4730122000,03/28/2021,"
My ant was located on a window seek near house plants. It had 2 antennas, 6 legs, and no wings.<\/p>\n",Hymenoptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/D2FD859A-3C7D-4759-826E-CD9375C40B8B.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/0951CC81-FAA3-4D01-9B9F-969D6337A640.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/ED7177EC-10C0-43DF-8A22-0DEDB9235E21.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/CDC56D0D-ABF4-47C8-82F3-C7E5263B8589.jpeg,","
My pellet was small and white. When using the pipet to take out part of the supernatant, I disturbed the pellet. I had to redo this step.<\/p>\n",No,,,,
"",37.0343000047,-76.4753452068,03/25/2021,"
Regular black ant with 6 legs, found on a sidewalk near the James river<\/p>\n",Hymenoptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/Arthropod-second-gel.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/Arthropod-Controls.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/Wolbachia-Controls.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/Wolbachia-second-gel.jpg,","
Pellet was thin and wispy when it was made. It had not yet been made into a small pellet<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/E17E7250-61EA-454A-BD11-C79696EB406F.jpeg,",36.7282054000,-76.5835621000,04/01/2021,"
brown and speckled shell, white underbelly<\/p>\n",Isopoda,Edwards Buffer,,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/IMG_1031.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/IMG_1030.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/IMG_1029.jpg,","
My pellet was brown and chunky, this could show that I didn\u2019t grind my pellet enough. My supernatant was light clear brown.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/D6D932A2-C394-4884-BAAA-7C05AFC73D31-scaled.jpeg,",37.0930627000,-76.5147365000,03/30/2021,"
The moth was gray and small. It stayed mostly in place on the surface they were on. It had 2 sets of wings with a long thin golden stripe running along the wing. It had small antennae. It had large eyes and a fuzzy head.<\/p>\n",Lepidoptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/Screen-Shot-2021-05-05-at-10.17.19-AM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/Screen-Shot-2021-05-05-at-10.17.51-AM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/Screen-Shot-2021-05-05-at-10.16.15-AM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/Screen-Shot-2021-05-05-at-10.14.15-AM.png,","
The pellet was large and clearly visible as well as ovular in shape.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/1350B8AE-2D0B-4F6B-83AB-86C762574C71-scaled.jpeg,",37.0045105000,-76.3119726000,04/01/2021,"
The queen ant is black and brown. It has a small structure. Has 1 pair of wings. The wings are only brown. The bug has 6 legs that are brown and black. Four wings, sparse ribs; front wings are larger than back wings. Chewing type for the mouth part. Completed Metamorphosis.<\/p>\n",Hymenoptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/E873258A-F920-45C6-9CD5-2BA9FBF5F35A.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/E674D768-77B1-4EAB-90DB-8B22C0F63C34.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/B77AE5FF-C5CA-4347-91BD-458792D18BEC.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/46838E3A-46BE-4F07-B3E9-E9B2FE3EC149.jpeg,","
Overall I think I\u2019ve made no mistakes, however I struggled on the DNA extraction process. The pellet was very small and it was visible. The pellet was a brown color<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/F44A1CC4-3D9D-4FCA-A4AB-BB3697E7514E.png,",37.1248776827,-76.4823562616,04/02/2021,"
It looked like a normal roly-poly. It was still alive when I collected it. It had a hard shell and 14 legs; and it was a dark brown color.<\/p>\n",Isopoda,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/8DEF4C94-D636-4FCB-908A-80754D69C314.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/65DB6645-B2A5-42F9-A294-7ED7F195E35C.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/A73DC07E-DAA7-4186-A9E1-62B1FDD1C151.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/C204C6AF-2EDF-4D36-B9B1-9E64C58CC3F9.jpeg,","
The pellet was very small and hard to see. It looked clear though.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/2340DB91-36C8-4A18-8625-67EC3C229570-scaled.jpeg,",37.0468514868,-76.4892483829,03/29/2021,"
\n- Has 3 sections<\/li>\n
- tail is black<\/li>\n
- can\u2019t see legs<\/li>\n
- most of the body is tanish brown<\/li>\n<\/ul>\n",Armadillidium vulgare,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/8F26B803-3BB5-4E7F-A803-CD4DDE25DB6D.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/2B20E3FE-572B-4B07-8483-A485E5296002.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/9D445D50-39BD-4910-ACEB-5F9F1F84DBDF.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/BD96C643-C49A-4A21-8AD1-933320F29CB3.jpeg,","
Pellet was very clear<\/p>\n
May not have pipetted right<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/22B2B44D-6E36-41C7-A5EB-7B227BE1BBD8-scaled.jpeg,",37.1979926000,-76.4158129000,04/01/2021,"
Has intentas, is dark brown with hints of light brown, has ridges, has six legs, and has a tail that is split into two<\/p>\n",Dermaptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/C67AF85F-A9B7-4188-82AC-D31F898E8A19.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/5BBD7BA4-D93A-44A8-96E7-80D13416BE70.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/DBD8C90F-A214-460B-8C1D-76220E14E2BA.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/86663179-FF2B-4DFF-8BAB-0AE65124BC5D.jpeg,","
Pellet was visible. It was a brownish color. DNA ladder for arthropod gel is faint, no bands in water for arthropod, in\u00a0positive arthropod there is a band, in negative arthropod there isn\u2019t a band. In arthropod 02, 04, 11, 12, and 13 there are bands. In arthropod 01, 03, 04, 05, 06, 07, 08, and 09 there isn\u2019t a band. In wolbachia \u00a002, 04, 05, 11, and 13 there are bands. In wolbachia 01, 03, 06, 07, 08, 09, and 12 there aren\u2019t bands.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/44EAD7A3-66E5-409C-91DF-EB639E55A21E-scaled.jpeg,",37.1051496034,-76.4810425781,03/30/2021,"
A small black bug with 6 legs and no visible wings. It has two parts to it, and it has 2 antennas and ridges on the shell.<\/p>\n",Coleoptera,Edwards Buffer,Partial abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/AC725D88-18C5-4277-A303-ADAE3A262BF4.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/528D6DE8-C877-4525-8EB8-5548BEBB77EE.jpeg,","
My pellet was small cloudy and green.<\/p>\n
<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/59AAA25C-BC00-4ABB-A8C1-83F2645DE1B7.jpeg,",372209.0000000000,765331.0000000000,04/06/2021,"
It is a small ant, and it is curled up with 6 legs.<\/p>\n",Hymenoptera,Edwards Buffer,,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/C6602674-0ABF-4147-8FF8-5054B800FFE5.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/95828906-2A78-474D-932D-B9BAC4FD2141.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/978CB940-ABE5-4B30-9FAA-C2AC25935779.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/3A0D6BDD-74A2-47E1-B87A-1DDA7A37D2E0.jpeg,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/E0CE836E-6897-4F0B-A252-9C4807AE8C4A-scaled.jpeg,",37.1110000000,-76.4130000000,06/27/2021,"
antennas, 6 legs, and black<\/p>\n",Hymenoptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/2B168A1B-ECE2-413D-B87A-96E5420AFA5D-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/4124C2D6-C208-4CA7-AA6F-3AC4DB4DC320-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/585E1860-A355-43AD-BE42-48EF2B280627-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/4E1DDA97-81F5-4707-93B0-C77336096656-scaled.jpeg,","
Not enough supernatant and pipetted tiny tubes wrong. The pellet was small but visible.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/7A6B94F9-FD2F-4B36-90FE-255A9ABF8F9E-scaled.jpeg,",36.1444896000,-86.8011462000,03/03/2021,"
The Arthropod has 3 sections. It has six legs. It also has a pair of wings; the wings are split into two sections. It also has hair all around its body including the head. It has a long nose. It also has red eyes which occupy the majority of the head.<\/p>\n",Diptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/10824489-A612-4367-8A13-5968BBC4C15D-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/5D17339A-CC91-45FF-90F0-2E5FC1567414-scaled.jpeg,","
The pellet is translucent around perimeter
\nIt has a dark brown center
\nIt also has a white layer between the center and the outside<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/IMG_3807-preview-scaled.jpg,",37.2240829000,-76.6479826000,06/26/2021,"
The bug has a large abdominal area, a pair of antennae, 6 legs, and sturdy wings.<\/p>\n",Lepidoptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/IMG_1919.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/IMG_1920.jpg,","
My pellet was barely visible after centrifuging the tubes for 5 minutes. In the moment I thought I had messed up somehow, but it turned out that the pellet was just a bright color, therefore making it difficult to see. I also feel as though I forgot to set the pipette to the right measurements when using it.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/EE3F4687-005B-483E-8504-4272B0767AA9-scaled.jpeg,",37.0599900000,-76.5168900000,04/01/2021,"
\n- Has cool colors on the back<\/li>\n
- has wings<\/li>\n
- has 6 legs<\/li>\n
- has 3 parts to its body<\/li>\n
- has tiny hairs<\/li>\n<\/ul>\n",Diptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/E0836195-57F9-43EA-B7D5-0FDA107890EA.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/CF88FB38-8320-4C1F-A11C-6203EFBD66EE.jpeg,","
\n- Not sure if I got enough of the supernatant.<\/li>\n
- Not sure if I pipetted right into the gel<\/li>\n
- pellet was visible<\/li>\n<\/ul>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/00B5C3F1-F061-47DA-86B5-891B3ECB0DEA-scaled.jpeg,",37.1337730000,-76.4518180000,03/30/2021,"
Yellow lines\/stripes on the abdomen<\/p>\n
very big abdomen<\/p>\n
6 legs<\/p>\n
2 antennas<\/p>\n",Hymenoptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/84D9AF6C-5DAC-4E7B-989E-486A8F1E4ACB.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/B5983A31-3E3D-4C2E-9034-373930A0F795.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/B524A9DD-7480-48DF-92C0-F58A44CFE383.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/F3185015-35DD-4940-B8C3-5D7133327A06.jpeg,","
DNA extraction didn\u2019t squeeze bug enough<\/p>\n
pipetted tiny tubes wrong<\/p>\n
not\u00a0enough supernatant<\/p>\n
the pellet was very small but visible<\/p>\n
<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/42A08D37-BAF9-496F-A69C-06703229553E.jpeg,",42.6471380376,-82.8737220368,03/30/2021,"
It is a very small ant with dark body and has 6 light brown limbs<\/p>\n",Hymenoptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/CE97FE37-D8CE-4008-BD0A-7BAA6875CBB9.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/366AB7B0-B2CB-4EE4-ACCF-095D6737FF17.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/88F3E871-66F9-465D-8C26-105B38E42BD0.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/9AEBA3BB-E570-42B3-B8D3-C871F6A98991.jpeg,","
Arthropod DNA latter is faint
\n2 has arthropod band
\nNo band for beetle
\n4 has band
\n11,12,13 have bands
\nBand on 5
\nDNA walbechia dna later is much better
\nPositive and negative walbechia no band
\nNot sure if positive control gave a band
\nNo walbechia have bands, it is messed up<\/p>\n
<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/11207A98-B7D9-453B-8B27-4B4E949F9BE0-scaled.jpeg,",37.1218653922,-76.4683983848,04/01/2021,"
Has antenna, 14 legs, no wings, legs have little hairs, it\u2019s back is semi-clear, has a grey\/brown exterior, brown underside, has a pair of eyes<\/p>\n",Isopoda,Edwards Buffer,Partial abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/841F20C3-52C6-4044-A268-5171B50EAFE4.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/6B84A193-2CBD-4411-A18A-1D514D155995.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/C1FA7C65-8919-4E1E-93E1-098CFDE794CB.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/9D4135EA-534A-40A6-B249-EF442675431F.jpeg,","
The pellet was a lightish brown but it was visible.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/37D8DE84-2717-49F2-8689-95587CA84450-scaled.jpeg,",37.1075733470,-76.4395751191,04/04/2021,"
Small black flying arthropod with 2 wings and 4 legs. I found it in my car on the way to school and it was about 60\u00b0<\/p>\n",Odonata,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/Gel-A-Control.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/Gel-A-Sample.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/Gel-W-Control.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/Gel-W-Sample-1.png,","
My pellet was small and white and was barely visible. I messed up the gels while making them and poked through creating problems with the Wolbachia test.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/4A487456-6CF5-4608-8800-52D6B8D39198-scaled.jpeg,",36.1444896,-86.8011462,04/02/2021,"
I noticed that the Ant was sort of clear looking under the microscope, had black eyes and looked like it had a flat bottom half. Another thing is that it had six legs, had a circle band in side of the stomach.<\/p>\n",Hymenoptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/8C6461FA-C7C5-412F-B38F-513E42DFC9BD.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/7DE364DF-45A6-4766-BB6F-5050F2CDB872.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/FF3D6744-6032-4031-8F9E-0499A5FBD3A9.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/DED07E1D-EB80-4243-8DD3-D20BD10F842E.jpeg,","
My pellet was brown, it was actually pretty big and noticeable, I disturbed it once so I had to restart that process but then I finally got it.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/8629F46D-21AC-4AAB-9EC5-6C82081B4B30-scaled.jpeg,",37.2864367068253,-76.65798994758134,03/29/2021,"
Medium sized black ant, two part body, black head and body, six light brown legs, found on the side of a large tree<\/p>\n",Hymenoptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/F2F6897E-AD88-4A08-9651-7D7750CE62CF.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/1DA0AA7D-BF23-45C1-9577-2624D03C43B9.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/D1E0A74B-0E33-4C8B-A57C-92F64F6EC372.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/924BD15C-FFA9-4D7B-A40E-CA4F3B8BFFF3.jpeg,","
There was a very small amount of visible pellet which was pale white\/yellow, there could have been a miscalculation of the liquid in the cell lysis step the DNA could have been\u00a0diluted<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/49E39263-88C1-4DAE-8468-C08B87D27AEC-scaled.jpeg,",36.9468152,-76.5605078,10/02/2020,"
Small, black, flexible, found under rotting wood<\/p>\n",Isopoda,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/BE7154B2-58D5-4121-9DAD-74115D6FADC1.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/990920E1-BBDE-499B-ACFD-26C6417E90D3.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/9D5F7A2A-60E7-429F-B6C7-86E2EAE30C6F.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/EC7DAD2D-BABC-4DF7-B8B3-EDE73C7BADAB.jpeg,","
I had accidentally taken out a piece of the arthropod when extracting the supernatant from the pellet. I had to extract all the DNA from the piece of the arthropod.<\/p>\n",Yes,,,,
"",36.7282054000,-76.5835621000,03/19/2021,"
dark color<\/p>\n
small head<\/p>\n
could see 4 legs<\/p>\n",Hymenoptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/D75F10CD-18A1-43B8-941F-4CB58E825B9D.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/883B2CC0-9C05-43AA-8F6E-B774A51CBF60.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/1887F67C-E4B5-49E1-A74E-564895556907.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/6D24628B-143F-4F62-B0D7-A765642D4DCD.jpeg,","
Pellet was not visible<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/C07940A0-703B-445C-8826-887CDC3F5FBD-scaled.jpeg,",74.1216102434,29.9449670106,03/31/2021,"
My roly poly was brown and striped. It had 14 legs, 2 antennas, and dark, beady eyes.<\/p>\n",Isopoda,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/72340A4B-5E7C-411F-A0A5-04D6041ED748.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/7EDEA060-5715-494C-9B9B-94AC71078AF5.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/BA2FD603-4B35-4A82-BFAC-3FE0D78D0044.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/E75F7B89-24D4-4949-A47B-0ED3ECC95D47.jpeg,","
During my experiment, I had to grind my sample, but it was difficult. My roly poly kept getting stuck on the bottom. I was able to move it to the side and grind it, but I still may not have ground it enough.<\/p>\n
My pellet was small. It was only a few grey specks.<\/p>\n",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/5308DC6F-1496-441D-A542-DFAF524FDD5C-scaled.jpeg,",37.050162438955184,-76.49943323352366,04/01/2021,"
My roly-poly had 14 legs, dark bumpy eyes, grooves on its back, antennas, and spots on its back.<\/p>\n",Isopoda,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/ABF13B52-6636-4D9B-A4A6-7CC3339A9B59.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/D558CEFB-6906-455E-A186-55298F4019E2.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/1EC170BF-EC36-4FF7-B0E0-58CE5A0B0F49.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/B0891C5F-5765-4C4A-8050-03C3618B852A.jpeg,","
During Cell Lysis, when we placed our DNA in the very hot water, my cap popped open, but it didn\u2019t look like anything spilled. The pellet was still inside, so I kept going. Another error I made was that I put double the amount of isopropanol.<\/p>\n
My pellet was a small speck that looked murky and dark.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/D2416C86-B02B-47CF-9698-6D70C73A69B0-scaled.jpeg,",36.7282054000,-76.5835621000,03/30/2021,"
It was rolling around in the dirt and rolled up when I touched it into a ball.<\/p>\n
Small , 10 legs, brown and black, has a hard shell with scales
\nAntennas, black eyes<\/p>\n",Isopoda,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/C86AEBBA-5F2C-4BCC-B012-E61CD5B3A904.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/1D3B2A7C-FD3B-4362-A5E8-9F5840DD58B0.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/529FD7D7-14E2-42C0-A6B8-BFCEA0823F6B.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/A949B564-578C-4C6B-B421-9C08FCB6D5C0.jpeg,","
Pellet was visible.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/F697CEA0-349E-4748-8415-B430FD6774AC-scaled.jpeg,",37.26683487524038,-76.72020413013172,04/01/2021,"
This roly-poly was found under backyard flower pot with several roly-polys found in same area. The environment was dark and damp with the temperature at 50-40 degree fahrenheit in afternoon.<\/p>\n
The insect had segmentation, no wings, dark brown\/tan color, a stripe down the middle back, a spotted stripe along sides of back, and aproximately 9 legs were counted.<\/p>\n",Isopoda,Edwards Buffer,Whole arthropod,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/8432CDC6-7569-4CD9-8C81-6FA1A9D57E5A.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/1E7A61EF-E7BF-4FA1-9EF4-5D5E14754019.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/A75E195C-AD89-48E7-A02F-A3B3C8BCFBBE.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/10FF9AAA-594F-4B7C-9E9B-82473BB172B9.jpeg,","
Throughout the experiment, the gel wells weren\u2019t done correctly, for wells weren\u2019t deep enough.\u00a0Pipetting may also have had errors, for some may have punctured the wells.\u00a0DNA may have been accidently mixed slightly when held as well. The pellet of my insect appeared as a visible dark brown.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/4CF4CF71-7D14-4819-9188-430C4256C2D5-scaled.jpeg,",37.0723145399,-76.3313640795,03/30/2021,"
I found the cricket next to a pine tree. There were a lot of crickets around. The cricket had 2 antennas, 6 legs, 2 palps, 13 sections, and 3 tails. It was about 70 degrees outside.<\/p>\n",Orthoptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/FAAEB2CA-C75E-4956-98F0-752EDDB12B21.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/0ADF1685-14E3-49AB-AE1A-5AF0E98B5704.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/1B2C62C9-F99A-430C-B892-48C641DA4B4F.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/7DB59114-6E6A-4BFD-83F6-0565ABE2D2FE.jpeg,","
The Gel for the wolbachia part did not have to correct wells. The pellet was a clear white with a gray tint.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/60323AB4-E598-4B01-BE97-E66E246B9D88-scaled.jpeg,",37.0846536718,-76.3973256415,04/08/2021,"
I found the ant in the crack of a sidewalk near the street. I collected it in the afternoon, at about 7 p.m. there was a few other ants crawling with it. It was warm outside and a bit cloudy<\/p>\n",Hymenoptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/16C3AA85-95D6-45C7-B773-25985691E912.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/2832BF63-9063-436F-84BF-FBF87063EC66.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/68FA6ECD-B078-43C6-A11D-980198CB0470.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/D2B4F56C-B5E9-4704-B39E-566D975E5052.jpeg,","
The buffer with dna was clearly seperated from the cell debris and many off the legs and the exoskeleton was very visible at the bottom also. The pellet was white colored and was visible as specks on the side of the tube.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/B7D357AF-9ABB-4665-BC11-36F2745F83AC-scaled.jpeg,",37.0770000000,-76.4850000000,04/01/2021,"
They were about a half an inch long each . They weren\u2019t very active when I caught them under a moist log. They are both gray in color and were close together when found.<\/p><\/blockquote>\n",Isopoda,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/82B056BE-0854-47AC-8FAE-F77F6D06AE2E.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/C4C779D0-1F1B-4184-A3AE-0C84D08F54BF.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/4B07C68B-8E32-47B7-85B1-EAD783ABBCC8.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/D87684CA-8A2D-4809-BF50-F8F2D55B0064.jpeg,","
When doing the gel part the gel crumbled causing us to let the gel sit for a little longer than ten minutes. The pellet was gray and large in size.<\/p>\n
<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/8F5266D5-D86B-4187-AB2E-A53EDFCFBC4B-scaled.jpeg,",36.9905555954,-76.5550016532,03/31/2021,"
Hybrid Russian honey bee, found outside hive, collected at about 5 pm, partly cloudy, 53 degrees<\/p>\n",Apis mellifera,Edwards Buffer,Partial abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/9113422B-3D4A-435D-88E7-A0B7D730EE04.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/E19C34BE-17C4-4220-93B5-DFF86B9C96E3.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/B43E8EB7-8C70-4D85-B428-335D75495D3C.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/DF644E5A-8045-4B80-8669-FCF6E8087696.jpeg,","
Added more Edwards\u2019s buffer because there was to little supernatant<\/p>\n
Pellet: large, yellowish brown<\/p>\n
gells were not properly prepared, the comb was inserted before gel was added, this led to inconsistently shaped wells.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/EAAA3D10-C750-4BB0-8991-FEEF78E6CE39-scaled.jpeg,",37.1140460000,-76.3929370000,04/01/2021,"
It was about a quarter of an inch long, had 6 legs, a small head, dark back, light belly, hard exoskeleton, and 2 leg like things at the bottom. I found it in a mound of dirt next to the wooden fence in my back yard. It was pretty wet and around 50 degrees that day.<\/p>\n",Isopoda,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/E23114C7-841F-4E7D-A505-B19D8797C3C1.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/0764346F-DE45-44CE-A88A-4FA2832E3922.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/665A58F9-7A73-48D6-A502-33398EAC0CE6.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/BFA622A1-26E0-45D8-854A-9EAD693B2D23.jpeg,","
The gels on the wolbachia test round were very shallow and crumbled a bit so we had to let them sit longer in the molds. My DNA pellet was small and visible, and dark brown.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/AAC2B4D5-6D98-4FB4-B2E0-68C3971F1B8C-scaled.jpeg,",37.1286200000,-76.4365200000,04/02/2021,"
6 legs, segmented, wings, antenas, furry.<\/p>\n",Coleoptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/0485F319-E199-4F54-BC23-D985EE48261D.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/82C23582-F99D-44EB-B454-F8E12DF162E3.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/2E6E0772-6EBE-456E-A148-02F3725A112C.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/61743190-18F1-421C-81B2-8668D7467808.jpeg,","
The pellet was very large and dark.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/3E80F246-26CC-4869-B63C-54FF2E32F8EB-scaled.jpeg,",37.2702951399,-76.7341489828,04/01/2021,"
Ovular shape<\/p>\n
Brown colored, lighter on the underside of the body<\/p>\n
Scale-like divisions throughout the body<\/p>\n
7 pairs of legs<\/p>\n
1 set of antennae<\/p>\n
No wings<\/p>\n",Isopoda,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/E8353184-B7A3-4CAB-A63F-FDFB63BB5FB1.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/7AEB38C6-B2C4-44CA-81AE-422DB93A9112.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/7E3859E0-673B-49D3-B5B2-3FE3DB435833.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/F502FAD9-906B-48EE-A228-8916D9306488.jpeg,","
The pellet had a small ovular shape. It\u2019s color was light brown.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/63E3B4A1-83EE-40F8-AD91-71261C9BA164-scaled.jpeg,",37.10374358821448,-76.44933517376774,05/31/2021,"
It is brown and black. It has seven pairs of legs and two pairs of antennae. Its body is segmented.<\/p>\n",Malacostraca,Edwards Buffer,Other,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/4F129C14-D232-4882-A113-936FDE4ACC42.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/741765E6-D942-432C-85CB-D076767E669D.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/4AAC2BCB-45C7-40CC-8E74-8A8EE2039972.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/22B21CB8-4AF6-430F-9D64-76EB58162470.jpeg,","
My pellet was visible and black and big.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/723CC539-138E-4A6E-A6AA-B6373614694D-scaled.jpeg,",37.1223664000,-76.3457773000,04/01/2021,"
2 antenna, 3 sets of legs, shell, not reactive to light<\/p>\n",Coleoptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/F04EAC35-47B8-44D3-BB2A-1D2B7C308FCD.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/C526FCFF-98EF-49F5-8DD5-F26ED4D938DE.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/CF8158C7-63D3-4B5D-923E-013FE40B48DF.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/9595ACFB-B067-4B4E-A7DC-97769268B151.jpeg,","
The pellet was small, visible, and dark in color.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/AE8C10B0-B05B-413A-BECB-71B16F7E6FF1-scaled.jpeg,",37.0316993000,-76.4674925000,03/30/2021,"
![\"\"](\"https:\/\/wolbachiaprojectdb.org\/wp-content\/uploads\/2021\/04\/AD60BAA1-AE7A-4CB7-8B19-0D1677B17558-300x91.jpeg\")
<\/p>\n",Formicidae,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/79A9DD61-D1CA-43AF-9056-8F65856E9B7D.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/3D3D87C9-53B8-4997-A3EC-B7456995BF51.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/27659100-E049-432D-9C7D-E1ADC3469A59.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/2E9EF6D9-690C-4E83-9EEF-ADB740936281.jpeg,","
The pellet was dark, small, and barely visible.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/323A8B37-B24E-4BAB-A173-ACB4695769C0.jpeg,",37.1048900000,-76.4419670000,03/30/2021,"
It rolls into a ball.<\/p>\n
It has antennae.<\/p>\n
It has 14 legs.<\/p>\n
It had a see through back.<\/p>\n",Isopoda,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/38B049D6-2737-4F8C-AA57-9BA2C846C127.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/E5AD6D8F-343E-4636-A312-06A790C71B92.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/C2E4A1E1-7ABE-4F8B-B18F-D5024E791EDB.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/9E8FE015-EB71-49A7-8B08-2B034A398477.jpeg,","
The pellet was dark and visible.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/66320E93-D2FE-4531-8750-462F539D90BB-scaled.jpeg,",36.8470976801,-76.4923673169,03/31/2021,"
The ant was a giant compared to others, it was brown with black strips on its back, the weather was sunny and it was caught in a forest, this ant was found in a log<\/p>\n",Hymenoptera,Edwards Buffer,Abdomen,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/10A6344D-8BCB-4EE9-ACCD-F564F0EE1508.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/DF03FC8F-8691-47AE-90FD-95881C970185.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/E819278A-3823-4EC6-AD0F-32A4B6F54ACB.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/1D97EEDD-AB86-467C-8D4D-E185B2AA7559.jpeg,","
The only mistake was that the gel for Wolbachia was made wrong so the answers are not completely clear the pellet was white and covered the entire bottom of the tube some people also poked the gel while inserting into pcr machine<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/F8627C3D-1A3E-42D4-A00F-BDD7B8BFBE80-scaled.jpeg,",37.0870821000,-76.4730122000,04/01/2021,"
The arthropod is similar to an ant, but longer, has a black body, yellow legs, no wings, antennae, and a sectioned rear.<\/p>\n",Blattodea,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/26DF29E7-FA6E-46F2-85EA-068174D2E40E.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/36B9426D-B490-4CBF-A96C-340E628E74A2.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/C3C6E4CC-ADB8-48AE-A171-3847905CE01E.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/977EA3C1-35B3-422F-99F6-5D818C691DDB.jpeg,","
I crushed my pellet firstly, which took a amount of time though it seemed to eventually settle in the bottom of the tube. My pellet was very dark and very compacted. Most of the experiment went as planned, though their was one hiccup on our part described in the confidence level explanation.<\/p>\n",Yes,,,,
"",37.2416104580,-76.7329463255,03/30/2021,"
The ants were walking in a line to and from the large azalea bush, which has the nest in it. They used a crack in the driveway for shelter.<\/p>\n",Hymenoptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"","
The pellet was not visible<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Schwarzer-Moderkafer-oben.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Schwarzer-Moderkafer-unten.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Schwarzer-Moderkafer.png,",47.4601031876,9.0178371223,03/11/2021,"",Ocypus olens,Edwards Buffer,Partial abdomen,Standard electrophoresis system,TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Gel.jpeg,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/29-04-_2021_10-42-38.jpg,",47.4609173283,9.0174179576,03/18/2021,"
Found under tree bark<\/p>\n",,Edwards Buffer,Partial abdomen,Standard electrophoresis system,TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Resultate-Elektrophorese.jpg,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/29-04-_2021_10-37-49.jpg,",47.4602629641,9.0186712132,03/18/2021,"
Found under tree bark<\/p>\n",,Edwards Buffer,Abdomen,Standard electrophoresis system,TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Resultate-Elektrophorese.jpg,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/amaurobius-fenestralis.png,",47.4611734127,9.0138447299,03/18/2021,"
We found our sample in a forest (marked on map) beneath the bark of a dead tree.<\/p>\n",Amaurobius fenestralis,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/842b0392-3e97-4b98-93d4-4a487ab80c55-2.jpg,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/29-04-_2021_10-31-41.jpg,",47.4605601318,9.0178456951,03/18/2021,"
Found under tree bark<\/p>\n",Chelidurella acanthopygia,Edwards Buffer,Abdomen,Standard electrophoresis system,TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Resultate-Elektrophorese.jpg,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Larve.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Larve-ganz.jpeg,",47.4599297936,9.0177133320,03/11/2021,"",Hylotrupes bajulus,Edwards Buffer,Partial abdomen,Standard electrophoresis system,TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Gel.jpeg,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Kellerassel-Oben.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Kellerassel-Seite.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Kellerassel-Unten.png,",47.4599643228,9.0176576761,03/11/2021,"",Porcellio scaber,Edwards Buffer,Partial abdomen,Standard electrophoresis system,TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Gel.jpeg,","",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/PHOTO-2021-04-29-10-09-05.jpg,",47.4596496828,9.0236533855,03/18/2021,"
found under a tree bark, weather was rather cold with snow<\/p>\n",,Edwards Buffer,Abdomen,Standard electrophoresis system,TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Bild_2021-04-29_101254.png,","",No,,,,
"",,,,"
It was caught onto a spider web but it had wings so therefore it was a mosquito.<\/p>\n",Chilopoda,Puregene (Qiagen),,Standard electrophoresis system,LB,GelGreen,"","
With the results, I think it turned out to be Wolbachia negative.<\/p>\n",No,,,,
"",,,,"",,,,,,,"","",,,,,
"",,,10/04/2020,"
It was caught on a spider web it was stuck on outdoors during the fall at 55 degrees F in a terrestrial habitat.<\/p>\n",Chilopoda,Puregene (Qiagen),,Standard electrophoresis system,LB,GelRed,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Gel-1-CO1-6.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Gel-2-Wspec-7.png,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-10.42.50-AM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-10.42.59-AM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-10.42.36-AM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-10.42.16-AM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-10.42.08-AM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-10.42.00-AM-2.png,",41.6755924000,-88.1965390000,11/02/2026,"
\u00a0Sample was found on a planter that had tomatoes, and carrots. Specimen was found by pulling one of the carrots out<\/span><\/p>\n",Insecta,Puregene (Qiagen),,Standard electrophoresis system,LB,GelRed,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Gel-1-CO1-3.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Gel-2-Wspec-4.png,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Beetle.jpg,",41.7508391000,-88.1535352000,10/04/2020,"The cedar beetle was found in an old foundation of a shed that houses broken and rotted wood. The beetle was relatively inactive with slow movements throughout the wreckage.\u00a0<\/span><\/p>\n",Coleoptera,Puregene (Qiagen),,Standard electrophoresis system,LB,GelRed,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Capture.jpg,","The band was really faint and there wasn’t enough DNA to get a sequence.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-10.16.18-AM.png,",41.7508391000,-88.1535352000,10/04/2020,"
It was under a plant pot. I looked under the plant pot and there was this pill bug. There were only two there. There was only mud around it. There was no greenery from where I could see. It was on a wooden deck in which it was moist.<\/span><\/p>\n",Isopoda,Puregene (Qiagen),,Standard electrophoresis system,LB,GelRed,"","",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-10.26.22-AM-1.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-10.25.11-AM-2.png,",41.6886512000,-88.1940384000,10/04/2021,"The insect I found was walking very quickly along the sidewalk but stopped when I covered it with the cup and even stayed still while I was up close to it, taking the picture. Also, the sidewalk it was roaming on was surrounded by a field of grass, so it most likely came from the grass. The insect was caught on a pretty cold day, right about the time the sun was setting.<\/span><\/p>\n",Coleoptera,Puregene (Qiagen),,Standard electrophoresis system,LB,GelRed,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-10.42.10-AM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-10.42.35-AM.png,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-10.25.20-AM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-10.25.38-AM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-10.25.21-AM.png,",41.6852177196,-88.1985204769,10/04/2020,"Was sitting near sprouting point of grass, little movement, resting. Started hopping upon being disturbed. Was not exhibiting any abnormal behavior.<\/p>\n",Melanoplus ponderosus,DNeasy (Qiagen),Abdomen,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Gel-2.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-10.42.10-AM.png,","",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-10.25.32-AM.png,",,,10/04/2020,"
The beetle was found in the mulch underneath the soil. It was 54 degrees outside.<\/p>\n",Coleoptera,Puregene (Qiagen),,Standard electrophoresis system,LB,GelRed,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-Gel.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Gel-2.png,","",No,,,,
"",41.4024166000,-88.2768445000,10/04/2020,"
I found it on my clothing in a pumpkin farm so it wasn’t in its natural habitat. But we know the location it came from.<\/p>\n",Araneae,Puregene (Qiagen),,Standard electrophoresis system,LB,GelRed,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Gel-2-Wspec-3.png,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-7.58.37-AM.png,",41.7080926000,-88.1945213000,10/04/2020,"
The sample was found alone in the mulch near flowers. The small, black insect has the ability to fly and walks at a slow pace.<\/p>\n",Sicariidae,Puregene (Qiagen),,Standard electrophoresis system,LB,GelRed,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-8.05.58-AM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-8.08.25-AM.png,","
\n- Arthropod Collection and Identification – The arthropod must be collected and placed in a closed container. Then it was identified using iNaturalist.<\/li>\n
- DNA extraction – The arthropod was then crushed and a part of the fungus gnat was dissected.<\/li>\n
- DNA amplification – The DNA was then amplified so it would be easier in the next step to visualize.<\/li>\n
- DNA Visualization – A gel electrophoresis was run in order to visualize the results.<\/li>\n
- DNA Sequence – To analyze the data from the gel electrophoresis and gain a better understanding of the DNA the nucleotides present are graphed.<\/li>\n<\/ol>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-8.13.57-AM.png,",41.6745692000,-88.2283325000,10/04/2020,"
\n- Was near about 5-6 other field crickets<\/span><\/li>\n
- Moves every time a loud noise occurs<\/span><\/li>\n
- Hops, but does not cover much distance<\/span><\/li>\n
- Very well blended into the grass<\/span><\/li>\n
- Was near high grass by a pond<\/span><\/li>\n<\/ul>\n",Orthoptera,Puregene (Qiagen),,Standard electrophoresis system,LB,GelRed,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-gel.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-8.08.25-AM.png,","",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-08-at-8.00.10-AM.png,",41.7081094000,-88.1945129000,10/04/2020,"
Found on the floor of my garage, jumping fast and was aware<\/p>\n",Acheta domesticus,DNeasy (Qiagen),Abdomen,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/results1.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/results2.png,","
![\"\"](\"https:\/\/wolbachiaprojectdb.org\/wp-content\/uploads\/2021\/04\/Screenshot-2021-04-08-at-8.17.51-AM-300x143.png\")
<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_5054-scaled.jpg,",41.7081094000,-88.1945129000,10/04/2020,"
It was crawling amongst the crevices in a rotting wooden log. When disturbed it rolled up. It has 14 legs. It is a dark grey\/blackish color. It has lines on its back to allow it to roll up.\u00a0<\/span><\/p>\n",Armadillidium vulgare,Puregene (Qiagen),Abdomen,Standard electrophoresis system,LB,GelRed,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Untitled-presentation.jpg,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-09-at-7.51.52-AM.png,",41.6967777000,-88.1974148000,,"\n- Found in dirt and mulch<\/span><\/li>\n
- \u00a0near plants<\/span><\/li>\n
- \u00a0tried to dig itself underground\u00a0<\/span><\/li>\n<\/ul>\n",Hymenoptera,Puregene (Qiagen),,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Gel-2-Wspec-7.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Gel-1-CO1-6.png,","",No,TTTTTAGTATATTATATATTCATCTGGCTTTTTGGATGCACCGATGAGAGATCCAGTTTTCACAGCGAACGCTATGGCTT,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/55-CO1-F.fasta,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/bug-pic-scaled.jpg,",,,10/01/2020,"
The insect was trailing up and down the stone in a single file line with the other insects of its species, carrying things.<\/p>\n",Tetramorium immigrans,,,,,,"","",No,,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/57-CO1-F.fasta,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_0695-scaled.jpg,",41.7080786000,-88.1924259000,10/05/2020,"
I found the boxelder bug on my brick wall house. I found it early in the morning like 6 or 7 . The bug was very tame went into the bag easily.<\/p>\n",Rhopalidae,Puregene (Qiagen),Whole arthropod,Standard electrophoresis system,LB,GelRed,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/BOXELDER-bug-.png,","",No,,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/41-CO1-F.seq_.fasta,,
"",41.6854670000,-88.1985810000,10/04/2020,"
The grasshopper was just hopping around with the other grasshoppers there and vibing in the grass.<\/span><\/p>\n",Orthoptera,Puregene (Qiagen),,Standard electrophoresis system,LB,GelRed,"","",No,,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/65-CO1-F.fasta,,
"",,,,"",,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_1893-scaled.jpg,",41.6928217000,-88.1947075000,10/04/2020,"ant was walking around on the cement with no other ants. there were some leaves and twigs around the location of the ant as well<\/p>\n",Formicidae,DNeasy (Qiagen),Abdomen,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Gel-2-Wspec-9.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Gel-1-CO1-8.png,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-09-at-7.57.15-AM.png,",41.6967777000,-88.1974148000,10/04/2020,"
I found my insect walking on the sidewalk. I covered it with the cup right away, and it immediately moved to the edge of the cup, as it was trying to get out. It was very active, and even when I put it in the bag, it was still moving around a lot.<\/p>\n",Nysius raphanus,Puregene (Qiagen),,Standard electrophoresis system,LB,GelRed,"","",No,,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/63-CO1-F.fasta,,
"",,,,"
Stuck on a web<\/p>\n",Chilopoda,DNeasy (Qiagen),Whole arthropod,,,,"","",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-09-at-7.55.53-AM.png,",41.7508391000,-88.1535352000,10/04/2020,"
The bug didn\u2019t move a lot especially when I put it in a cup and tried to transfer it to the Ziploc bag. It was damp outside today because during the night it rained and so the plant that the bug was resting at was pretty moist. The plant was also a few feet in the air and hangs so it isn\u2019t for an insect to get there.<\/span><\/p>\n",Hermetia illucens,Puregene (Qiagen),,Standard electrophoresis system,LB,GelRed,"","",No,,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/68-CO1-F.fasta,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-09-at-7.53.12-AM.png,",41.6809839000,-88.1437782000,10/04/2021,"\n- It was collected in the morning & the outside temperature was 60 degrees Fahrenheit<\/li>\n
- Spider was located in a cobweb in the top corner of the garage\u00a0<\/span><\/li>\n
- Spider is smaller than a grain of rice<\/span><\/li>\n
- Light brown in color<\/span><\/li>\n
- Legs are not long, look proportional to body\u00a0<\/span><\/li>\n
- Slightly bulbous abdomen\u00a0<\/span><\/li>\n<\/ul>\n",Theridiidae,Puregene (Qiagen),,Standard electrophoresis system,LB,GelRed,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Gel-1-CO1-4.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Gel-2-Wspec-5.png,","",No,,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/58-CO1-F.fasta,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-09-at-7.56.20-AM-2.png,",41.7081094,-88.19451289999999,10/22/2026,"
\n- It went from my patio chair to under my patio table<\/span><\/li>\n
- It flew in short distances<\/span><\/li>\n
- It is a brown\/black bug with transparent wings<\/span><\/li>\n
- It was moving around a lot and was more by man made structures<\/span><\/li>\n<\/ul>\n",Chironomidae,Puregene (Qiagen),,Standard electrophoresis system,LB,GelRed,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Gel-1-CO1-7.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Gel-2-Wspec-8.png,","",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/fruit-fly.png,",41.7306000000,-88.1976700000,10/04/2020,"
The fly was flying at a rather fast pace and was very anxious it seemed. I had to trap it with a banana since it was so fast. As it is incredibly small, it is hard to distinguish many features without a magnifying glass.<\/span><\/p>\n",Drosophila melanogaster,Puregene (Qiagen),Whole arthropod,Standard electrophoresis system,LB,GelRed,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/wolbachia-data.png,","",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/dobsonfly.jpg,",41.7080926,-88.19452129999999,10/05/2020,"\n- lived in shady grass<\/li>\n
- possibly flying<\/li>\n
- midday<\/li>\n<\/ul>\n",Corydalidae,Puregene (Qiagen),,Standard electrophoresis system,LB,GelRed,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Gel-1-CO1-1.png,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Microbe-Hunters0006-scaled.jpg,",41.03238729185046,-112.25628487238001,03/23/2021,"
from a distance it looked, small, shinny, and smooth, it was black and had a hard exoskeleton\u00a0<\/i><\/b><\/p>\n
When I took a look up close he was a lot cooler, the legs were kind of curled, and his back had\u00a0these grayish white spots that I did not spot before, there are these little hare like things on each of its legs he looks kind of like a spider but black, round, and has less body parts<\/b><\/i><\/p>\n",Coleoptera,DNeasy (Qiagen),Whole arthropod,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-02-11.53.28-AM.png,","
we followed recommended contentions for wolbachia primer’s we only used the standerd reagent from miniCPR<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Microbe-Hunters0019-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Microbe-Hunters0018-2-scaled.jpg,",40.9580848000,-112.2145571000,03/23/2021,"",Lithobiomorpha,DNeasy (Qiagen),Partial abdomen,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-02-11.48.32-AM.png,","
we used recommended conditions for Wolbachia Primers only. we used standard reagents for MiniPCR.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Doppelschwanz.jpg,",47.4607021502,9.0177295821,03/11/2021,"
place: under a piece of wood in the forest near Wil SG and Sirnach (Switzerland)<\/p>\n
temperature: about 10\u00b0C<\/p>\n",Campodeidae,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Gel-6-scaled.jpg,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/pseudoskorpion.jpg,",47.4603428287,9.0168563887,03/11/2021,"
place: under leaves, in the earth<\/p>\n
temperature: about 10\u00b0C<\/p>\n
weather: cloudy<\/p>\n",Cheliferoidea,Edwards Buffer,Abdomen,Standard electrophoresis system,TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Gel-5-scaled.jpg,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Formica-rufa.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Formica-rufa-2.jpg,",47.4601588525,9.0187961803,03/11/2021,"
I found the ant under some dry leaves in a small forest.<\/p>\n",Hymenoptera,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/Gel.jpg,","
Analysis: The control and SZ2 were the only one which worked.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Ohrwurm.jpg,",47.4605813707,9.0167437444,03/11/2021,"
Place: It was found under a piece of wood in the forest near Wil SG and Sirnach (Switzerland).<\/p>\n
Temperature: about 10\u00b0C<\/p>\n
Weather: cloudy, no rain, no sunshine, no frosting<\/p>\n
<\/p>\n",Chelidurella acanthopygia,Edwards Buffer,Abdomen,Standard electrophoresis system,TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Gel-4-scaled.jpg,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Ameise-Seite-scaled.jpg,",47.4597364670,9.0202699915,03/11/2021,"
![\"\"](\"https:\/\/wolbachiaprojectdb.org\/wp-content\/uploads\/2021\/04\/Ameise-1-225x300.jpg\")
<\/p>\n",Lasius niger,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Gel.png,","
Negative result on line SS1
\nWolbachia positive on line WB+<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Schnurfusser.jpg,",47.4596196173,9.0204147590,03/18/2021,"
We found the insect under a tree bark.<\/p>\n",Unciger foetidus,Edwards Buffer,Partial abdomen,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Gel-Elektrophorese.png,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Spinne-Seite-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Spinne-oben.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Spinne-unten.jpg,",47.4594443990,9.0204043686,03/11/2021,"
![\"\"](\"https:\/\/wolbachiaprojectdb.org\/wp-content\/uploads\/2021\/04\/Spinne-300x163.jpg\")
<\/p>\n",Pardosa lugubris,Edwards Buffer,Partial abdomen,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Gel.png,","
Negative result on line VF1
\nWolbachia positive on line WB+<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Gemeine-Stubenfliege.jpg,",47.4612431409,9.0166212515,03/11/2021,"
The fly was cought under a rotting tree bark.<\/p>\n",Musca domestica,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/gelbeschriftung.png,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Marienkafer.jpg,",47.4596232928,9.0203556330,03/18/2021,"
We found it unde ra tree bark<\/p>\n",Cryptocephalus,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Gel-Elektrophorese.png,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Ameise.jpg,",47.4610098434,9.0163117342,03/11/2021,"
The spider was caught on the floor of the forest. The area was between a rotting tree strunk and a sapling. The floor was full with dead leaves.<\/p>\n",Lasius niger,Edwards Buffer,Whole arthropod,Standard electrophoresis system,TAE,Fast Blast,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/05/gelbeschriftung-1.png,","",No,,,,
"",32.6556723000,-97.1036838000,03/23/2021,"
The Stone Dwelling centipede has a more circular head that has a number of simple eyes. These are darkly pigmented and when they are numerous, they form a dark patch on each side of their head. Their antennae are quite long, usually at least one-third of the length of the body. Predator to small insects and other smaller arthropods, prey to shrews, toads, badgers, and birds.<\/span><\/p>\n",Lithobiomorpha,DNeasy (Qiagen),Whole arthropod,MiniPCR,TBE,GelGreen,"","We followed the recommended conditions for Wolbachia primers only. We used the standard reagents from MiniPCR.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-02-12.06.31-PM.png,",41.0524417000,-112.2393920000,03/23/2021,"
I had went to antelope island and the weather was a lil windy and cold I had found my bug on a rock<\/p>\n",Chilopoda,DNeasy (Qiagen),Larva,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-02-11.55.20-AM.png,","
we followed the recommended conditions for wolbachia primers only we used the standard reagent from miniPCR<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Microbe-Hunters0030-1.jpg,",40.95808479999999,-112.2145571,03/22/2021,"
I found it in the soil under a rock<\/p>\n",Agelenidae,DNeasy (Qiagen),Whole arthropod,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Screenshot-2021-04-02-11.54.42-AM.png,","
we followed the recommended conditions for wolbachia primers only. we used the standard reagents from MinniPCR<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Microbe-Hunters0016-scaled.jpg,",41.0349373000,-112.2497377000,03/23/2021,"
This specimen was quite small for it’s species, ( about half an inch long ) leading me to believe that it was quite young.<\/p>\n",Dysderidae,DNeasy (Qiagen),Abdomen,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Canyon-_-Abi-3_31_21.jpeg,","
Followed recommended procedure for wolbachia only primers<\/p>\n",No,,,,
"",,,10/11/2020,"
This insect was caught in a field with tall grass.<\/p>\n",Diptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"","
The DNA showed a clear test and the controls worked well.<\/p>\n",,,,,
"",,,10/11/2020,"
This specimen was collected in a field with tall grass.<\/p>\n",Diptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"","
The DNA showed a clear test and the controls worked well.<\/p>\n",,,,,
"",,,10/11/2020,"
It was caught in a large field with tall grass.<\/p>\n",Diptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"","
This was conducted by professionals in a lab.<\/p>\n",No,,,,
"",,,10/11/2020,"
Caught in a field with long tall grass. The abdomen of the creature had a long blue fuzz growing on it. Estimated length to be half a centimeter. The pale blue fuzz disappeared when specimen was placed in the collection tube with alcohol. The fuzz has not been identified.<\/p>\n",Diptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"","
This was conducted in a lab setting.<\/p>\n",No,,,,
"",,,,"",,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_192042966_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_205254821_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_205251530_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_192048797_iOS-1-scaled.jpg,",36.02028991587827,-86.7378387086951,10/04/2020,"
on a spider plant leaf in a NE facing flower bed in a suburban back yard, 73 degrees F<\/p>\n
some sort of caterpillar; ~1cm long, yellow head, green underbelly, black mottled back<\/p>\n",Lepidoptera,DNeasy (Qiagen),Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/Unknown-caterpillar.jpg,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_191952876_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_192009888_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_192015770_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_192002357_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_204528191_iOS-1-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_204946216_iOS-scaled.jpg,",36.0203210068,-86.7378564911,10/04/2020,"
found on spider plant leaf in NE corner of garden in flowerbed<\/p>\n
looks similar to a mealy bug covered in white fuzz with dark brown scaly protrusion that is bilaterally symmetrical; rest is white fluff; ~1cm<\/p>\n",Insecta,DNeasy (Qiagen),Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/mealy-bug-larvae.jpg,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_191307784_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_191307001_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_204326225_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_204312595_iOS-1-scaled.jpg,",36.02028531985114,-86.73779822979762,10/04/2020,"
found on aster in a flowerbed, NE location in backyard behind suburban home<\/p>\n
2mm long, all black, two wings, delicate legs<\/p>\n",Diptera,DNeasy (Qiagen),Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/unknown-black-fly.jpg,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_191114754_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_204124185_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_204101939_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_191122115_iOS-scaled.jpg,",36.02028588012979,-86.73785166558416,10/04/2020,"
caught in suburban back yard on an impatient flower; caught at 2:15 p.m.; 73 degrees F<\/p>\n
<\/p>\n
~1cm long, looks like a fly with black legs and thorax, and a yellow abdomen, two wings, large brown eyes<\/p>\n",Diptera,DNeasy (Qiagen),Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/unknown-yellow-fly.jpg,","",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201003_222204476_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201003_222207025_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201003_222210174_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_203547613_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_203518060_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_203536432_iOS-scaled.jpg,",36.02014505854512,-86.73802686315759,10/03/2020,"
some sort of spider sitting in its web which hangs from birch branch, southfacing side of the tree<\/p>\n
<\/p>\n
small (~1\/2cm), pointed abdomen is brown, dark thorax, pale legs<\/p>\n",Araneae,DNeasy (Qiagen),Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/unknown-spider.jpg,","",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201003_221655923_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201003_221650422_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_203229586_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201003_221653821_iOS-scaled.jpg,",36.02033001661619,-86.73786439621657,10/03/2020,"
found on stem of vine in a patch of mulch under a birch tree; found in front yard on west side of house; 5:25pm; 70 degrees F; they are aphids<\/p>\n",Coleoptera,DNeasy (Qiagen),Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/aphid.jpg,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201003_221734293_iOS-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201003_221727175_iOS.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201003_221730491_iOS.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_203026899_iOS-scaled.jpg,",36.0202454969,-86.7378319642,10/03/2020,"
1\/2cm, ant, reddish brown color<\/p>\n
found on the bark of a birch tree in a suburban front yard on the west side of house; 5:20pm<\/p>\n",Hymenoptera,DNeasy (Qiagen),Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/unknown-ant.jpg,","
did not have ladder<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201003_221121209_iOS-1-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201003_221103247_iOS-1-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_202859465_iOS-3-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_202724878_iOS-1-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/20201004_202752971_iOS-3-scaled.jpg,",36.0202163975,-86.7380877842,10/03/2020,"
found in suburban front yard on a blade of grass beneath a Bradford pear tree; fluttered around low to the ground<\/p>\n
~1.5cm, looks like a small moth, two antennae, two mouth parts, cream-colored<\/p>\n",Lepidoptera,DNeasy (Qiagen),Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/unknown-moth.jpg,","",Yes,,,,
"",,,10/11/2020,"
This insect was caught in a field with tall grass.<\/p>\n",Hemiptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"","
This was conducted in a lab. The controls worked as expected. The bands were clear.<\/p>\n",No,,,,
"",,,10/11/2020,"
This insect was collected in a field with tall grass.<\/p>\n",Orthoptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"","
This extraction was performed in a professional lab.<\/p>\n",Yes,,,,
"",42.00014444371294,-88.35933343827395,10/11/2020,"
This insect was collected on a tall grass field.<\/p>\n",Diptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"","
This was conducted in a lab.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_5347-scaled.jpeg,",37.0870821000,-76.4730122000,10/13/2020,"",Coleoptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-20.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-20.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-Control-2-2.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-controls-2-2.png,","
Visible pellet<\/p>\n
<\/p>\n",No,,,,
"",37.0870821000,-76.4730122000,10/17/2020,"",Blattodea,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/Screen-Shot-2021-03-09-at-12.57.27-PM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-15.png,","
Small visible pellet<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_5352-scaled.jpeg,",37.0870821000,-76.4730122000,10/12/2020,"",Lithobiomorpha,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-19.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-19.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-Control-2-3.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-controls-2-3.png,","
No Visible pellet<\/p>\n
<\/p>\n",No,,,,
"",37.0870821000,-76.4730122000,10/16/2020,"",Hemiptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/Screen-Shot-2021-03-09-at-12.52.17-PM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/Screen-Shot-2021-03-09-at-12.51.56-PM-1.png,","
Visible pellet<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_5341-scaled.jpeg,",37.0870821000,-76.4730122000,10/13/2020,"",Isopoda,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-17.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-17.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-Control-2-2.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-controls-2-2.png,","
Visible pellet<\/p>\n
<\/p>\n",Yes,,,,
"",37.0870821000,-76.4730122000,10/16/2020,"",Hemiptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-13.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-13.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-controls-1-3.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Controls-1-3.png,","
Very small pellet<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_5345-scaled.jpeg,",37.0870821000,-76.4730122000,10/11/2020,"",Dermaptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/B941C44F-1A0A-4942-8E0B-F823E6784FB7.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/3B722820-7584-4232-ABA1-73DE707D9315.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-Control-2.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-controls-2.png,","
No visible pellet<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_5350-scaled.jpeg,",37.0870821000,-76.4730122000,10/12/2020,"",Blattodea,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-16.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/820AB9D4-5164-4C39-B406-C04263680B05.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-Control-2-2.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-controls-2-2.png,","
Visible pellet<\/p>\n
<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_5173-scaled.jpeg,",37.0870821000,-76.4730122000,10/16/2020,"
Visible pellet<\/p>\n",Phasmatidae,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-12.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-12.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-controls-1-3.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Controls-1-3.png,","
Arthropod gel: Controls didn’t work. Water should not have a band.<\/p>\n
Wolbachia gel: Wolbachia DNA and controls didn\u2019t work.<\/span><\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_5344-scaled.jpeg,",37.0870821000,-76.4730122000,10/11/2020,"",Lepidoptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/937051F9-0EB2-4592-9A7A-79568C6AFB09.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/BD66C42F-DAAF-4A17-875D-874EAA275AB3.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-Control-2-1.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-controls-2-1.png,","visible pellet<\/p>\n
<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_5171-scaled.jpeg,",,,10/16/2020,"",Orthoptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/7740F845-3D02-4312-A3F7-03708EC2605F.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/2BEEA8D4-E776-4327-945A-2FBF95FAEEE8.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-controls-1-2.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Controls-1-2.png,","
Visible pellet, broken up<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_5170-scaled.jpeg,",,,10/16/2020,"",Diptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/3B3D1301-90CD-45A7-998C-9AC0EEE5A7FB.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/7C127EC9-5D63-425A-BC60-CEBDC093078F.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-controls-1-2.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Controls-1-2.png,","
DNA extraction very small<\/p>\n
<\/p>\n",No,,,,
"",,,10/16/2020,"",Diptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-6.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-6.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-controls-1.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Controls-1.png,","
Pellet visible broken up<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_5172-scaled.jpeg,",36.1444896000,-86.8011462000,10/17/2020,"
Visible pellet<\/p>\n",Orthoptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/874FDA5C-A8C6-4F01-861D-DD7EAAC75FCE.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/CE554412-D347-4AA9-AE8E-2EBF8356D455.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-controls-1-1.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Controls-1-1.png,","
Arthropod gel – controls didn’t work<\/p>\n
Wolbachia gel- Controls and Wolbachia DNA didn’t work<\/p>\n
<\/p>\n
<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_5166-scaled.jpeg,",,,10/16/2020,"",Diptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-5.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-5.png,","
pellet visible, broken up<\/p>\n
<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_5169-scaled.jpeg,",,,10/16/2020,"",Diptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/D3E3317C-E379-487B-B6CD-14790D4C000A.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/C69C31F4-D902-4E9D-8D07-672B3635736C.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-controls-1-2.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Controls-1-2.png,","
Visible pellet, broken up.<\/p>\n
<\/p>\n
<\/p>\n",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_5165-scaled.jpeg,",,,10/16/2020,"",Hymenoptera,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-4.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-4.png,","
visible pellet<\/p>\n
<\/p>\n
<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_5164-scaled.jpeg,",37.0870821000,-76.4730122000,10/16/2021,"",Hymenoptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/7C317477-E935-4E4F-BB3F-D05B407E0808.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/869A5269-F234-4299-854A-5BB2FB496A26.jpeg,","
DNA extraction – good, visible pellet<\/p>\n
<\/p>\n
<\/p>\n
<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_5167-scaled.jpeg,",,,10/16/2020,"",Diptera,Edwards Buffer,Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/1395DB84-520A-42B7-A3FE-75FFB1CA242D.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/03/A8AD786C-17D9-4334-A7EE-FDFFE7BB42D5.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-controls-1-2.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-Controls-1-2.png,","
DNA extraction very small pellet.<\/p>\n
<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/IMG_5163-scaled.jpeg,",,,10/20/2020,"",Araneae,Edwards Buffer,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Arthropod-2.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/04/Wolbachia-2.png,","
Visible Pellet<\/p>\n
<\/p>\n",No,,,,
"",38.0002121000,-98.7445075000,08/17/2020,"
The box elder bugs were found on a tree and seemed to be apart of a colony. The bugs estimated infection rate is 12.5%.<\/p>\n",Hemiptera,DNeasy (Qiagen),Abdomen,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/02/Untitled-presentation-2.jpg,","
The boxelder bugs were stored in 90% ethanol for about six months prior to extraction.<\/p>\n
DNA Extraction: The DNA was extracted from the abdomen. All of the Dneasy (Qiagen) protocols were followed. The extraction took two days to complete.<\/p>\n
PCR: Mini One Taq polymerase was used.<\/p>\n
Gel Electrophoresis: Mini PCR was used. All of the lanes worked well and were bright and clear.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/compressor.png,",42.5065305495,-71.4126194567,10/01/2020,"
This was found in a pitfall trap baited with honey at the edge of the woods.<\/p>\n",Formicidae,DNeasy (Qiagen),Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/02/Screen-Shot-2021-02-02-at-10.27.40-AM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/02/Screen-Shot-2021-02-02-at-10.27.57-AM.png,","",No,NNNNNNNNNNNNNNGNNNNNNNNNTNCTNNNNNTNNATCCTGNAANTCCNGAGNNNNGANTGGNNNNCTACCNTATNNNNNNNNNNNNNNNNNNNNNNTTANN,,,
"",38.0015316151,-98.7432222016,07/20/2020,"
These fireflies were collected after dark in the grass.<\/p>\n",Lampyridae,DNeasy (Qiagen),Abdomen,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/01/Untitled-presentation-1.jpg,","
The fireflies were stored in 90% ethanol for about six months prior to extraction.<\/p>\n
DNA Extraction: The DNA was extracted from the abdomen. All of the Dneasy (Qiagen) protocols were followed. The extraction took two days to complete.<\/p>\n
PCR: Mini One Taq polymerase was used.<\/p>\n
Gel Electrophoresis: Mini PCR was used. All of the lanes worked well and were bright and clear.<\/p>\n",No,,,,
"",38.0012506544,-98.7440012919,08/13/2020,"
The bagworms were found in their cases on cedar trees.<\/p>\n",Lepidoptera,DNeasy (Qiagen),Abdomen,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/01/Untitled-presentation-1.jpg,","
The bagworms were removed from their cases and were stored in 90% ethanol for about five months prior to extraction.<\/p>\n
DNA Extraction: The DNA was extracted from the abdomen. All of the Dneasy (Qiagen) protocols were followed. The extraction took two days to complete.<\/p>\n
PCR: Mini One Taq polymerase was used.<\/p>\n
Gel Electrophoresis:\u00a0 Mini PCR was used. All of the lanes worked well and were bright and clear.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/01/IMG_20201105_112927347-scaled.jpg,",38.9366492,-77.0402873,11/02/2020,"
Collected on misty morning from car door frame<\/p>\n",Tipula,Instagene Matrix,Abdomen,Standard electrophoresis system,TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/01/Will-Damian-Gel.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2021/01/COI-and-Wolbachia-separate-gel.jpg,","
\n\n\nWe first ran duplex PCR reaction (with both COI and\u00a0Wolbachia<\/em>\u00a0primers) and then ran separate PCR reactions with just COI and just\u00a0Wolbachia<\/em>\u00a0primers<\/td>\n<\/tr>\n\n| <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n",No,,https://wolbachiaprojectdb.org/wp-content/uploads/2021/01/crane-fly.fa,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG_1067-scaled.jpeg,",36.1771060000,-86.7471210000,09/24/2020," The ant was easy to capture considering my hands are huge and it’s tiny. At first it tried to run away but I had sugar on my gloves and it seemed to be attracted to it. The ant was small, less then an inch small and had a thin black coat as the shell of the body.<\/p>\n",Insecta,,Abdomen,,Other,,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/12/Slide1-e1608529434513.jpg,"," -Wolbachia positive<\/p>\n -Easy to see in gel image.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/12/IMG_20201105_112836752.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/12/IMG_20201105_112800535-scaled.jpg,",38.9565958,-77.2094826,10/27/2020," I found this ladybug larvae on the front porch of my home underneath a light. It was the only one nearby.<\/p>\n",Harmonia axyridis,Instagene Matrix,Abdomen,Standard electrophoresis system,TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/12/Will-Damian-Gel.jpg,","",No,CTCCTCTTTCTTCTAATTTAACACATAATGGGCCTTCAGTAGATTTAGTGATTTTTAGTTTACATTTAGCAGGAATTTCCTCAATTTTAGGTGCAGTAAATTTCATTTCAACTATTATAAATATACGTCCATTTGGTATAATACTTGATAAAACTCCTTTATTTGTATGATCTGTTCTTATTACAGCAATTCTTTTATTACTATCACTACCAGTTCTTGCAGGAGCAATTACTATACTATTAACTGACCGAAACTTAAATTCTTCTTTTTT,https://wolbachiaprojectdb.org/wp-content/uploads/2020/12/Will_Bug_FASTA.fa,,
"",38.9382603990,-77.1027213316,11/01/2020," Found on the garage door near my house at around 3:30 PM. It had rained the night before.<\/p>\n",Aedes albopictus,Instagene Matrix,Abdomen,Standard electrophoresis system,TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/12/COI-and-Wolbachia-separate-gel-1.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/12/Luke-Dr.-O-Gel.jpg,"," We first ran a duplex reaction. Then, we ran two separate PCR reactions: one with just Wolbachia primers, and one with just COI primers.<\/p>\n",Yes,CTAAGAGTTTTAATTCGTATTGAACTTAGACATCCTGGTATATTTATTGGAAATGATCAAATTTATAATGTAATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATCATAATTGGAGGATTTGGAAACTGACTAGTACCCTTAATACTAGGAGCCCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGAATATTACCCCCCTCTTTAACACTGCTGCTTTCTAGTTCTATAGTAGAAAACGGAGCTGGAACAGGGTGAACGGTTTATCCTCCTCTTTCTTCTGGAACAGCTCATGCTGGGGCTTCAGTTGATTTAGCAATTTTTTCTTTACATTTAGCGGGAATCTCATCTATTTTAGGAGCAGTAAATTTTATTACAACTGTAATTAATATACGATCAACTGGTATTACTCTTGATCGACTACCTTTATTTGTGTGATCAGTAGTAATTACAGCTATTTTATTACTTCTTTCTCTACCCGTATTAGCCGGAGCTATTACTATATTATTAACAGACCGAAATTTAAATACATCTT,https://wolbachiaprojectdb.org/wp-content/uploads/2020/12/Luke_mosquito_COI-COI_F.fa,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/12/IMG_1915-rotated.jpg,",38.0041154000,-98.7600424000,11/19/2020," I purchased Triop eggs online and raised them. I was only able to get 3 to hatch out and those were the ones I extracted.<\/p>\n",Notostraca,DNeasy (Qiagen),Abdomen,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/12/Untitled-presentation.jpg,"," The Triops were raised for about 2 weeks until they reached full size. They were then stored in 90% ethanol for a day until extraction.<\/p>\n DNA Extraction: The DNA was extracted from the abdomen.\u00a0 All of the Dneasy (Qiagen) protocols were followed. The extraction took two days to complete.<\/p>\n PCR: Mini One Taq polymerase was used.<\/p>\n Gel Electrophoresis: Mini PCR was used. All of the lanes worked well and were bright and clear.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/12/IMG_20201215_154333621-scaled.jpg,",38.9374808000,-77.0852258000,10/31/2020," I found this ladybug on my kitchen window at home.\u00a0 There were about 5-6 ladybugs trying to get into window from outside.<\/p>\n",Coleoptera,Instagene Matrix,Abdomen,Standard electrophoresis system,TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/12/Luke-Dr-O-Gel.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/12/COI-and-Wolbachia-separate-gel.jpg,"," We first ran duplex PCR reaction (with both COI and Wolbachia<\/em> primers) and then ran separate PCR reactions with just COI and just Wolbachia<\/em> primers<\/p>\n",No,AGTAGGAACATCGTTAAGTATTTTAATTCGGTTAGAATTAGGAACTAGAGGAAGATTAATTGGAAACGACCAAATTTATAATATAATTGTTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTAATACCTATTATAATTGGGGGTTTTGGAAATTGATTAGTTCCTTTAATAATTGGAGCTCCTGATATAGCATTTCCACGATTAAATAACATAAGATTTTGACTTTTACCCCCTGCTTTAACTCTTTTAATTTTAAGAACAATCGTAGAAATAGGGGCAGGAACAGGATGAACTGTTTACCCTCCTCTTTCTTCTAATTTAACACATAATGGGCCTTCAGTAGATTTAGTGATTTTTAGTTTACATTTAGCAGGAATTTCCTCAATTTTAGGTGCAGTAAATTTCATTTCAACTATTATAAATATACGTCCATTTGGTATAATACTTGATAAAACTCCTTTATTTGTATGATCTGTTCTTATTACAGCAATTCTTTTATTACTATCACTACCAGTTCTTGCAGGAGCAATTACTATACTATTAACTGACCGAAACTTAAATTCTTCTTTTTTTGACCCAACCGGTGGGGGAGACCCAATTTTATACCAACATTTATTTTGATTTTTTG,https://wolbachiaprojectdb.org/wp-content/uploads/2020/12/Mod2.WspecF.fa,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/IMG_3927-scaled.jpg,",,,10/04/2020,"When I caught the second bug it was so much easier. The bug as long legs like the first but this mosquitoes body was even smaller which makes me believe there is no Wolbachia in it.<\/p>\n",Culex,,,,,,"","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/IMG_3926-scaled.jpg,",,,10/04/2020," When I caught the mosquito it was more difficult than expected. Every time I went to go grab one it flew away. When I caught it I looked at it and the legs were very long and the body was very small.<\/p>\n",Culex,,,,,,"","",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/IMG_1858-rotated.jpg,",38.0001781000,-98.7445481000,07/29/2020," The ticks were collected off of my dog during the late summer. They had not yet burrowed into the skin.<\/p>\n",Ixodida,DNeasy (Qiagen),Abdomen,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/Wolbachia-Project-3.jpg,"," The ticks were stored in 90% ethanol for about three months prior to extraction.<\/p>\n DNA Extraction: The DNA was extracted from the abdomen.The abdomen was sliced open due to the tough exoskeleton. All of the Dneasy (Qiagen) protocols were followed. The extraction took two days to complete.<\/p>\n PCR: Mini One Taq polymerase was used.<\/p>\n Gel Electrophoresis:\u00a0 Mini PCR was used. All of the lanes worked well and were bright and clear.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/IMG_1859-rotated.jpg,",38.0001701000,-98.7445612000,09/16/2020," The flea was captured off of my dog in mid September. He had been under some trees.<\/p>\n",Siphoneptera,DNeasy (Qiagen),Whole arthropod,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/Wolbachia-Project-3.jpg,"," The flea was stored in 90% ethanol for about two months prior to extraction.<\/p>\n DNA Extraction: The DNA was extracted from the whole arthropod. All of the Dneasy (Qiagen) protocols were followed. The extraction took two days to complete.<\/p>\n PCR: Mini One Taq polymerase was used.<\/p>\n Gel Electrophoresis:\u00a0 Mini PCR was used. All of the lanes worked well and were bright and clear.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/fungusgnat33remote-scaled.jpeg,",42.5119345549,-71.3979608914,10/09/2020," The fungus gnat was collected\/found in a patch of grass in between mowed and unmowed lawn, so there were some well-maintained lawn and some dryer, yellow grass with weeds. There were also very few leaves in the area, and it was fairly open. There was also mulch a few feet away from the area. It was around 10:00 AM when the gnat was collected. It was about 65\u00ba F and cloudy.<\/p>\n",Mycetophilidae,DNeasy (Qiagen),Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/02/Screen-Shot-2021-02-02-at-10.36.19-AM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2021/02/Screen-Shot-2021-02-02-at-10.36.06-AM.png,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/AMaqtedar4.jpeg,",,,," Relatively large Housefly<\/p>\n",Musca domestica,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/Screen-Shot-2020-11-09-at-10.08.46-AM.png,",42.4785882565,-71.4596435772,10/01/2020," Small Tick<\/p>\n",Ixodidae,,,,,,"","",,,,,
"",36.0775432,-86.7315785,09/24/2020," The beetle was found with many of the same species on a stump. It was extracted from the stump, which was damp and dark. It was 5:30 pm and around 70 degrees Fahrenheit.<\/p>\n",Megalodacne,DNeasy (Qiagen),Whole arthropod,MiniPCR,TBE,GelGreen,"","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/2827557866911240542.jpg,",36.0775432000,-86.7315785000,," This arthropod was found underneath a rock in my front yard, along with several other insects of varying species. This was done in the afternoon, fairly warm out too but I do not have an exact measurement of the temperature. It was the only roly poly I managed to find. It was curled up, probably in an attempt to hide or protect itself from me, however, it had the opposite effect as I was able to grab it and submerge it in ethanol easier than if it were moving around.<\/p>\n",Armadillidae,DNeasy (Qiagen),Abdomen,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/Screenshot-2020-11-04-171526.png,"," Gel Electrophoresis Review – Cal Neel<\/a><\/p>\nMy results are labeled under number 27 and 26. 27 was a common woodlouse and 26 was a carpenter ant. My pill bug tested positive for Wolbachia, however, my ant definitely did not.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/IMG_1065-scaled.jpg,",36.1768873000,-86.7480349000,09/24/2020," This pavement ant was the second caught ant from my collection. It liked the sugar on my glove and was not frantic nor did it run away. It crawled around the glove until it was submerged in the ethanol. Had a thin black shell that covered the entirety of its body.<\/p>\n",Insecta,,,,,,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/Screenshot_8.png,","",No,,,,
"",,,11/04/2020," Very small fly<\/p>\n",Hexapoda,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/IMG_20201104_143819415_MP-scaled.jpg,",42.4836453,-71.4418101,10/02/2020," A black beetle thats length is 16mm<\/p>\n",,,,,,,"","",Unknown,,,,
"",,,01/01/2021," 5 millimeters<\/p>\n",,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/IMG_7302.jpg,",,,," We found this spider in unmowed lawn near an open field. It was collected on October 2nd, 2020 in the afternoon. The area was surrounded by tall grasses and plants.<\/p>\n",Pholcidae,,,,,,"","",,,,,
"",42.47946491840872,-71.45769770902969,10/10/2020,"",Orthoptera,,,,,,"","",,,,,
"",37.3554104,-93.3993751,10/21/2020," found on concrete<\/p>\n very fast compared to other insects in the vicinity<\/p>\n 72 degrees F<\/p>\n",Coleoptera,,Abdomen,,,,""," abdomen was removed carefully with scissor tools<\/p>\n",Unknown,,,,
"",37.300994599999996,-93.4174773,10/21/2020," 72 degrees F<\/p>\n Field of tall grass<\/p>\n was among many other grasshoppers, including many different species<\/p>\n windy day<\/p>\n",Orthoptera,,Abdomen,,,,""," Carefully removed abdomen with small scissor tool<\/p>\n",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/IMG-9453-scaled.jpg,",37.301,-93.417,10/22/2020,"",Orthoptera,,,,,,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/IMG-9444-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/IMG-9447-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/IMG-9451-scaled.jpg,","",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/damselfly-scaled.jpg,",37.301,-93.417,10/22/2020,"",Odonata,,,,,,"","",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/butterfly-scaled.jpg,",37.301,-93.417,12/23/2020,"",Lepidoptera,,,,,,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/IMG-9430-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/IMG-9439-scaled.jpg,","",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/BalaG1-scaled.jpg,",42.4801552477,-71.4567887381,10/01/2020," The leaf beetle was caught in the abandoned garden at the high school. The weather that week was sunny and ranged from 65-76 degrees F. It was one of the bigger insects caught in the garden, despite its small size.<\/p>\n",Chrysomelidae,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/Sophia1-scaled.jpg,",42.4777221504,-71.4584327922,10/01/2020," The spider was collected in a patch of woods in between the high school and a football field. It was sunny that week, with a low of 65 and a high of 76 degrees F. The spider was one of the largest insects collected in the cup, and seemed to be the only spider collected.<\/p>\n",Lycosidae,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/AAashi-5-scaled.jpg,",42.4788913244,-71.4546912505,10/01/2020," We set out cups of slightly soapy water with the openings flush to the ground. The ant was found in a grassy area close to a construction site.<\/p>\n",Lasius emarginatus,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG_2452.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG_2455.jpg,",37.3004,-93.4183,10/21/2020," Found in the grass, shaded by a tree. Temp outside was 75 degrees F<\/p>\n",Orthoptera,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/pgarro-2-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/220px-Oniscidea_woodlouse_morphology.png,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/download.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/images-1.jpeg,",42.4785594770,-71.4582102460,10/01/2020," ![\"\"](\"https:\/\/wolbachiaprojectdb.org\/wp-content\/uploads\/2020\/10\/pgarro-2-146x300.jpg\") <\/p>\n
Our group found only one sample of this species. The collection site was within a maintained\/ mowed area, which may have an impact on species collected as well.<\/p>\n",Armadillidium vulgare,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG_2447.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG_2444.jpg,",37.3004,-93.4183,10/21/2020," Found flying in tall grass, temp outside was 75 degrees F<\/p>\n",Diptera,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG_2433.jpg,",37.3004000000,-93.4183000000,10/21/2020," Found living under a heavy rock, the rock was cooler than the temperature outside. It was a sunny day, but the temperature outside was about 75 degrees F.<\/p>\n",Armadillidae,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG-4497-1-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG-4503-1-scaled.jpg,",37.3009789000,-93.4168276000,10/23/2020,"",Araneae,,,,,,"","",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/Mhu2insect-1-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/images.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/southern-yellowjacket-Vespula-squamosa.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/images-2.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/Bees-hornets-wasps_yellow-jacket_profile_350x350.jpg,",42.4785510637,-71.4590322504,10/01/2020," ![\"\"](\"https:\/\/wolbachiaprojectdb.org\/wp-content\/uploads\/2020\/10\/Mhu2insect-225x300.jpg\") <\/p>\n
Our group found this yellowjacket in an area that was not maintained (as the collection site was in the woods). We only collected one sample of many species, but were able to collect two samples of the Southern Yellowjacket.<\/p>\n",Vespula squamosa,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/rove-beetle.jpg,",37.301,-93.418,10/20/2020," We caught this in the field infront of the high school.<\/p>\n",Coleoptera,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/sac-spider-butt.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/sac-spider-mouth.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/sac-spider-whole-body-scaled.jpg,",39.2320000000,-93.3600000000,10/21/2020," This was also caught indoors, in Faith’s Livingroom.<\/p>\n",Araneae,,,,,,"","",,,,,
"",37.3013447,-93.4168724,10/22/2020," Outdoor temp: 82 degrees F<\/p>\n Wasp was on Goldenrod flowers when caught<\/p>\n Habitat: tall grass (field)<\/p>\n",Hymenoptera,,,,,,""," We used a small scissor tool to carefully remove the abdomen from all other parts of the insect.<\/p>\n",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/red-paper-wasp-whole-body.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/red-paper-wasp-head.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/red-paper-wasp-stinger-.jpg,",37.301,-93.418,10/20/2020," This was found inside in WHS, in the hallways.<\/p>\n",Hymenoptera,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/Ezhong2-scaled.jpg,",42.4811823535,-71.4606381074,,"",Hemiptera,Puregene (Qiagen),Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/02/1.jpg,","",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/Jzhang1-scaled.jpg,",42.4805656765,-71.4596952686,10/02/2020," The woods near leary<\/p>\n",Geotrupes splendidus,DNeasy (Qiagen),Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2021/02/1-1.jpg,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/Resized_20201026_125118001.jpg,",37.3554104,-93.3993751,10/21/2020,"",Orthoptera,,Abdomen,,,,"","",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/large-cricket-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/Resized_20201026_123746001.jpg,",37.3554104000,-93.3993751000,10/21/2020,"",Orthoptera,,Abdomen,,,,"","",Unknown,,,,
"",37.30031042358681,-93.41824913863964,10/21/2020," Grass<\/p>\n urbanized area<\/p>\n mildly wet<\/p>\n",Diptera,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/grasshopper2.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/grasshopper1.jpg,",37.3347932000,-93.4149334000,10/23/2020," It was caught in an open short grassy field.<\/p>\n",Orthoptera,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG_5253-scaled.jpg,",37.3010000000,-93.4160000000,10/21/2020," Web was sitting in tall grass, secluded field<\/p>\n",Araneae,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/Screenshot-2020-10-29-at-2.08.47-PM.png,",37.2990000000,-93.4200000000,10/21/2020,"",Lepidoptera,,,,,,"","",,,,,
"",37.3013447,-93.4168724,10/21/2020," Grasshopper was on a tall grass blade. Looked to be alone.<\/p>\n",Orthoptera,,,,,,"","",,,,,
"",37.3013447,-93.4168724,10/21/2020," Ant was on top of the ant hill. Hundreds of ants chased me as I scooped one up. The ant had wings.<\/p>\n",Hymenoptera,,,,,,"","",,,,,
"",37.3013447,-93.4168724,10/21/2020," We found the pill but under a wet log. There were at least 100 of them.<\/p>\n",Isopoda,,,,,,"","",,,,,
"",37.301,-93.418,10/12/2020,"",,,,,,,"","",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG-9549.jpg,",37.3013447,-93.4168724,10/22/2020,"",Orthoptera,,,,,,"","",Unknown,,,,
"",37.3554104,-93.3993751,10/22/2020,"",Hemiptera,,,,,,"","",,,,,
"",37.3554104,-93.3993751,10/21/2020,"",Orthoptera,,,,,,"","",,,,,
"",37.3010000000,-93.4180000000,10/12/2020,"",,,,,,,"","",Unknown,,,,
"",37.301,-93.418,10/12/2020,"",,,,,,,"","",Unknown,,,,
"",37.3010000000,-93.3010000000,10/21/2020,"",Diptera,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG-9453-1-scaled.jpg,",37.3013447,-93.4168724,10/22/2020,"",Orthoptera,,,,,,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG-9451-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG-9444-1-scaled.jpg,","",Unknown,,,,
"",37.3009698000,-93.4167642000,10/26/2020,"",Crustacea,,,,,,"","",,,,,
"",37.3009698,-93.41676419999999,10/26/2020,"",Crustacea,,,,,,"","",,,,,
"",37.3009698000,-93.4167642000,10/26/2020,"",Crustacea,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG-3208-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG-3211-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG-3215.jpg,",37.3009525000,-93.4167638000,10/21/2020," We collected this cricket near the school at around 1 pm. It was about 70 degrees outside and we collected this cricket along with one other from a group of crickets.<\/p>\n iNaturalist: luke_christensen 73<\/p>\n",Gryllus,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/7.Blue_.SH_.Woody_.Beetle-scaled.jpg,",42.4850931000,-71.4328400000,11/29/2020," Found in wooded environment<\/p>\n",Geotrupes splendidus,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/butterfly-scaled.jpg,",37.3013447,-93.4168724,10/22/2020,"",Lepidoptera,,Abdomen,,,,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG-9430-1-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG-9439-1-scaled.jpg,","",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG-3221-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG-3225-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG-3227-scaled.jpg,",37.3009525000,-93.4167638000,10/21/2020," We found the field cricket near the school. It was collected in the afternoon around 1 pm, and it was around 70 degrees outside. There was more than one cricket, but we collected this one and one other.<\/p>\n <\/p>\n iNaturalist: luke_christensen 74<\/p>\n",Gryllus,,,,,,"","",,,,,
"",38.0001790000,-98.7445536000,08/19/2020," The larvae were found in sandy soil in their pits. There were a lot of other pits around. The adult was found in my backyard.<\/p>\n",Neuroptera,DNeasy (Qiagen),Abdomen,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/Wolbachia-Project-2.jpg,"," I stored my arthropods in 90% ethanol for about two months prior to DNA extraction.<\/p>\n DNA extraction: The DNA was extracted from the abdomen. All of the Dneasy (Qiagen) protocols were followed. The extraction took two days to complete.<\/p>\n PCR: Mini One Taq polymerase was used.<\/p>\n Gel Electrophoresis: All of the lanes worked except for the DNA ladder and the positive and negative controls. This may be due to a pipetting error. Importantly though my Wolbachia DNA worked.<\/p>\n <\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/FED6693B-AD53-4266-B611-2879DC5F027C.jpeg,",36.0802326000,-86.8320743000,09/24/2020," Found at the foot of a tree. There were several smaller ants nearby.<\/p>\n",Formicidae,DNeasy (Qiagen),Whole arthropod,,,,"","",,,,,
"",47.1600000000,8.4300000000,09/28/2020," \n- Collected from a pond<\/li>\n
- Humid<\/li>\n
- Autumn<\/li>\n
- 13\u00b0C<\/li>\n
- Elevation \u2013 538<\/li>\n<\/ul>\n",Cicadella viridis,Wizard SV (Promega),,,,,"","",No,TCTGGATGGTTGGGATAATACTAAGAATAATTATTCGAATTGAATTAGCTCAACCAGGATCATTTATTCTCAACGATCAAGTTTATAATGTAATTGTTACATCACATGCATTTATCATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGTTTTGGTAATTGATTATTACCTTTAATAATTGGTGCCCCGGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGACTTTTACCACCTTCATTAATTTTACTTATAACTAGTTCAATAGTTGAAATAGGAGCAGGAACCGGTTGAACAGTTTATCCCCCTTTATCATCTAATATTGCACATTCAGGTTCAAGAGTTGATTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCATCTATTTTAGGTGCAGTTAATTTTATTACAACTGTAATTAATATGCGAATACTAGGTATAAATTTTGATCAAACACCATTGTTTGTTTGATCAGTTATAATTACTGCTATTCTTTTATTACTATCTTTACCAGTTTTAGCTGGTGCTATTACTATATTATTAACAGATCGTAATTTAAATACATCTTTTTTTGACCCCTCAGGTGGTGGTGATCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCACC,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C024.fasta,,
"",47.1600000000,8.4300000000,09/28/2020,"
\n- Collected from a field with cows<\/li>\n
- Autumn<\/li>\n
- 13\u00b0C<\/li>\n
- Elevation \u2013 538<\/li>\n<\/ul>\n",Scathophaga stercoraria,Wizard SV (Promega),,,,,"","",No,TGATCCGGATAATTGGAACTTCTTTAAGTATTCTAATTCGAGCTGAATTAGGACATCCTGGAGCATTAATTGGAGATGACCAAATCTATAATGTAATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTGCCTCTTATATTAGGTGCTCCTGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGACTTTTACCACCAGCATTAACTTTATTGTTAGTAAGTAGTATAGTAGAAAACGGAGCTGGAACAGGATGAACTGTTTACCCTCCTTTATCTTCAAATATTGCTCATGGAGGAGCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCATCTATTTTAGGAGCTGTAAATTTTATTACAACTGTAATTAATATACGATCAACAGGAATTACTTTTGATCGAATACCTTTATTTGTATGATCTGTAGTAATTACAGCTTTATTACTTTTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATACTATTAACAGATCGAAATCTTAATACATCATTTTTTGATCCAGCAGGAGGAGGAGACCCAATTCTATATCAACATTTATTTTGATTTTTTGGTCACCGGGAAA,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C023.fasta,,
"",47.1600000000,8.4300000000,09/28/2020,"
\n- Collected from the woods<\/li>\n
- Autumn<\/li>\n
- 13\u00b0C<\/li>\n
- Elevation \u2013 538<\/li>\n<\/ul>\n",Loricera pilicornis,Wizard SV (Promega),,,,,"","",Yes,CAGGATAGTGGGAACCTCCCTAAGAATGTTAATTCGAGCAGAATTAGGGAATCCAGGTTCTTTTATTGGAGATGATCAAATTTATAATGTTATTGTTACTGCTCATGCATTTGTAATGATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAACTGACTTGTTCCTTTAATATTAGGTGCCCCTGATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGACWCCTTCCACCATCTCTTACTCTTCTCCTACTTAGAAGAATGGTAGAGAGAGGTGCTGGTACAGGATGGACCGTGTACCCTCCTCTTTCTTCTGTTATTGCTCATAGAGGGGCTTCAGTAGATTTAGCTATTTTTAGTCTTCACTTAGCAGGAGTATCATCAATTTTAGGAGCTGTAAATTTTATTAGTACAATTATTAATATACGATCTATTGGAATGACATTTGATCGAATACCACTATTTGTTTGATCAGTGGGAATTACTGCTCTACTTCTTTTACTTTCGTTACCAGTATTAGCTGGAGCAATTACTATATTATTAACTGATCGAAATTTAAATACATCCTTTTTTGATCCGGCGGGAGGAGGAGATCCTATTCTATATCAACATTTATTTTGATTTTTTGGTCACCTGGAAAGTTTAAA,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C022.fasta,,
"",47.1600000000,8.4300000000,,"
\n- Collected from the woods<\/li>\n
- Autumn<\/li>\n
- 13\u00b0C<\/li>\n
- Elevation \u2013 538<\/li>\n<\/ul>\n",Loricera pilicornis,Wizard SV (Promega),,,,,"","",Yes,CAGGATAGTGGGACCTCCCTAAGAATGTTAATTCGAGCAGAATTAGGGAATCCAGGTTCTTTTATTGGAGATGATCAAATTTATAATGTTATTGTTACTGCTCATGCATTTGTAATGATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAACTGACTTGTTCCTTTAATATTAGGTGCCCCTGATATAGCCTTTCCTCGAATAAATAATATAAGATTTTGACTCCTTCCACCATCTCTTACTCTTCTCCTACTTAGAAGAATGGTAGAGAGAGGTGCTGGTACAGGATGGACCGTGTACCCTCCTCTTTCTTCTGTTATTGCTCATAGAGGGGCTTCAGTAGATTTAGCTATTTTTAGTCTTCACTTARCAGGAGTATCATCAATTTTAGGAGCTGTAAATTTTATTAGTACAATTATTAATATACGATCTATTGGAATGACATTTGATCGAATACCACTATTTGTTTGATCAGTGGGAATTACTGCTCTACTTCTTTTACTTTCGTTACCAGTATTAGCTGGAGCAATTACTATATTATTAACTGATCGAAATTTAAATACATCCTTTTTTGATCCGGCGGGAGGAGGAGATCCTATTCTATATCAACATTTATTTTGATTTTTTGGTCACCCTGGAAGTTTAAA,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C021.fasta,,
"",47.1600000000,8.4300000000,09/28/2020,"
\n- Collected from underneath a stone<\/li>\n
- Autumn<\/li>\n
- 13\u00b0C<\/li>\n
- Elevation \u2013 538<\/li>\n<\/ul>\n",Trachelipus,Wizard SV (Promega),,,,,"","",No,TGGTGCTTGAGCAGGGGCTGTTGGAACAGCCCTTAGGATAATTATTCGGACTGAATTAGGAAACCCTGGAAGGTTAATTGGAGATGATCAGATTTATAATGTTATTGTGACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTCGGTAATTGATTAGTGCCTTTAATATTAGGGGCCCCTGATATAGCTTTTCCACGTATAAATAATATAAGGTTTTGGCTTCTCCCCCCATCACTAATCTTGTTATTAAGAAGGGGTCTAGTTGAAAGAGGGGTTGGGACTGGCTGGACTGTCTACCCACCTTTGGCAAGTGGAATCGCCCATAGAGGGGCTTCAGTAGATTTAGGGATTTTTTCCCTTCATTTGGCTGGAGCTTCTTCAATCTTAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGAGCAGAGGGGATAAGGATAGATCGTATTCCTCTATTTGTCTGGTCTGTGTTAATTACAGCAATTCTATTATTACTTTCACTACCGGTTTTAGCAGGGGCTATTACTATATTATTAACAGACCGTAATCTGAACACCTCTTTTTTTGACCCTAGGGGGGGAGGGGATCCTATCTTATACCAGCACTTATTTTGATTTTTTGGTCACCCTGAAAGTTTAAA,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C020.fasta,,
"",47.1600000000,8.4300000000,09/28/2020,"
\n- Collected from underneath a stone<\/li>\n
- Autumn<\/li>\n
- 13\u00b0C<\/li>\n
- Elevation \u2013 538<\/li>\n<\/ul>\n",Trachelipus,Wizard SV (Promega),,,,,"","",No,GCTGTTGGAACAGCCCTTAGGATAATTATTCGGACTGAATTAGGAAACCCTGGAAGGTTAATTGGAGATGATCAGATTTATAATGTTATTGTGACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTCGGTAATTGATTAGTGCCTTTAATATTAGGGGCCCCTGATATAGCTTTTCCACGTATAAATAATATAAGGTTTTGGCTTCTCCCCCCATCACTAATCTTGTTATTAAGAAGGGGTCTAGTTGAAAGAGGGGTTGGGACTGGCTGGACTGTCTACCCACCTTTGGCAAGTGGAATCGCCCATAGAGGGGCTTCAGTAGATTTAGGGATTTTTTCCCTTCATTTGGCTGGAGCTTCTTCAATCTTAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGAGCAGAGGGGATAAGGATAGATCGTATTCCTCTATTTGTCTGGTCTGTGTTAATTACAGCAATTCTATTATTACTTTCACTACCGGTTTTAGCAGGGGCTATTACTATATTATTAACAGACCGTAATCTGAACACCTCTTTTTTTGACCCTAGGGGGGGAGGGGATCCTATCTTATACCAGCACTTATTTTGATTTTTTGGTCACCTGGAAAGTTTAAA,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C019.fasta,,
"",,,09/28/2020,"",Autographa gamma,Wizard SV (Promega),,,,,"","",Yes,CTTTAAGATTACTAATTCGAGCAGAATTAGGAACCCCTGGATCATTAATTGGTGATGATCAAATTTATAATRCTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGTAATTGACTCGTTCCTCTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGTATAAATAACATAAGTTTTTGACTTTTACCCCCATCTTTAACTCTTTTAATTTCTAGAAGAATTGTAGAAAATGGAGCTGGTACTGGATGAACAGTTTATCCCCCACTTTCATCTAATATCGCCCATGGTGGAAGATCTGTTGATTTATCTATTTTTTCTTTACATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGATTAAATAGTTTATCTTTTGATCAAATACCTTTATTTATCTGAGCTGTTGGAATTACAGATTTCCTTTTATTACTTTCTTTACCAGTTTTAGCAGGGGCAATTACTATATACTTTTAACAGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGACCCAATCTTATACCAACATTTATTTTGCTTTTTTGGTCACC,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C018_TR-1.fasta,,
"",,,09/28/2020,"",Autographa gamma,Wizard SV (Promega),,,,,"","",Yes,GGTATTTGAGCTGGAATAGTTGGTACATCTTTAAGATTACTAATTCGAGCAGAATTAGGAACCCCTGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGTAATTGACTCGTTCCTCTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGTATAAATAACATAAGTTTTTGACTTTTACCCCCATCTTTAACTCTTTTAATTTCTAGAAGAATTGTAGAAAATGGAGCTGGTACTGGATGAACAGTTTATCCCCCACTTTCATCTAATATCGCCCATGGTGGAAGATCTGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGATTAAATAGTTTATCTTTTGATCAAATACCTTTATTTATCTGAGCTGTTGGAATTACAGCTTTCCTTTTATTACTTTCTTTACCTGTTTTAGCAGGGGCAATTACTATACTTTTAACAGATCGTAATTTAAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGACCCAATCTTATACCAACATTTATTTTGATTTTTTGGTCACCTGGAGAA,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C017.fasta,,
"",,,09/28/2020,"",Pentatoma rufipes,Wizard SV (Promega),,,,,"","",No,ATATGAGCAGGTATAGTAGGATCAGCTATAAGTATTATTATTCGAATTGAATTAGGTCAACCCGGAAGATTTATTGGAGATGATCAAATTTATAATGTTGTAGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATGCCAATTATAATTGGTGGGTTTGGAAATTGACTAGTACCTTTAATAATTGGAGCACCTGATATAGCCTTTCCACGAATAAATAATATAAGATTTTGATTATTACCCCCTTCATTAACATTATTAATAATAAGAAGATTAACAGAAGCTGGAGCTGGTACTGGCTGAACAGTTTACCCCCCTTTATCTAGAAATTTATCACACAGAGGAACTTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGCAGGGGTTTCTTCAATTTTAGGTGCAGTAAATTTCATTTCAACAATTATAAATATACGCCCAACTGGAATAACTCCCGAGCGAATTCCTCTATTCGTTTGATCTGTTGGAATTACAGCTTTACTTTTATTGTTATCACTACCAGTATTAGCTGGAGCTATTACAATATTATTAACAGATCGAAATTTTAATACATCATTTTTTGACCCCTCAGGGGGTGGGGATCCCATTCTTTATCAACATTTATTTTGATTTTTTGGTCACCTG,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C014.fasta,,
"",,,09/28/2020,"",Phoridae,Wizard SV (Promega),,,,,"","",No,GAGTCNTGATGGTGGGCACATCTTAAGAGTATGTAATTCGTGCTGAATTAGGGCGCCCCGGGCTTTATTTGGAGATGATCAAATTGATAATGTAATTTG,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C013_TR.fasta,,
"",47.2400000000,8.3100000000,,"
\n- Collected from the grass in an open, sunny field<\/li>\n
- Autumn<\/li>\n
- 15\u00b0C<\/li>\n
- Elevation \u2013 571<\/li>\n<\/ul>\n",Vespula germanica,Wizard SV (Promega),,,,,"","",No,GAGCAGGACTTTAGGAGCTTCAATAAGAATAATTATTCGTTTAGAATTAAGATCCCCTGGAGCTTTAATTAATAATGATCAAATTTATAATACTATTATTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTTATACCTTTTTTAGTTGGAGGATTTGGAAATTGATTAATCCCTTTAATATTAGGTGTTCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCATCCTTATTTTTATTAATCTTAAGAAATTTTATTGGAACCGGAGTAGGGACAGGATGAACTCTATACCCTCCTTTATCATCAATTGTAGGACATGACTCTCCCTCTGTAGACTTAGGAATTTTTTCTATCCATATTGCTGGAATTTCATCAATTATAGGTTCAATTAATTTTATTGTTACTATTTTAAATATACACACAAAAACACATTCACTAAATTTTCTTCCTTTATTTTCATGATCAATTTTAATTACAGCAATTCTTCTCTTGTTATCTCTACCAGTTCTTGCAGGAGCAATTACTATACTTCTTACAGACCGTAATTTAAATACATCTTTCTTTGATCCTGCAGGCGGAGGTGACCCAATTTTATATCAACATTTATTTTGATTTTTTGGTCACTG,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C012.fasta,,
"",47.2300000000,8.3200000000,09/28/2020,"
\n- Collected from a flower<\/li>\n
- Autumn<\/li>\n
- 15\u00b0C<\/li>\n
- Elevation \u2013 460<\/li>\n<\/ul>\n",Nezara viridula,Wizard SV (Promega),,,,,"","",No,GGTATATGAGCAGGAATAGTAGGATCAGCAATAAGATTAATTATTCGAATTGAACTAGGACAACCCGGAAGATTTATTGGAGATGATCAAATTTATAATGTAGTAGTAACAGCTCACGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATAATTGGTGCTCCAGATATAGCATTCCCTCGAATAAACAATATAAGATTCTGGTTATTACCCCCATCATTAACCCTTTTAATAGTAAGAAGATTAGCAGAATCTGGAGCAGGAACAGGATGAACTGTTTATCCTCCTTTATCTAGTAATTTATCTCATAGAGGAGCCTCAGTGGATTTAGCTATTTTTTCATTACATCTAGCAGGAGTATCATCAATCTTAGGCGCAGTAAATTTCATTTCAACTATTATTAATATACGACCAACAGGTATAACTCCAGAACGAGTTCCACTATTTGTTTGATCAGTTGGGATCACAGCATTATTATTACTACTTTCATTACCTGTACTAGCAGGTGCAATTACAATATTATTAACAGATCGGAACTTTAATACATCATTCTTTGACCCTTCAGGAGGGGGAGATCCCATTCTTTATCAACACTTATTTTGATTTTTTGGTCACCTGAG,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C011.fasta,,
"",47.2400000000,8.3100000000,09/28/2020,"
\n- Collected from dry, short grass in a meadow<\/li>\n
- Autumn<\/li>\n
- 15\u00b0C<\/li>\n
- Elevation \u2013 571<\/li>\n<\/ul>\n",Orthoptera,Wizard SV (Promega),,,,,"","",Yes,ATGAGCTGGATAGTAGGTACATCAATAAGAATAATTATTCGTGCAGAACTTGGACAACCAGGATCCATAATTGGAGATGATCAAATCTATAATGTTATTATTACAGCACATGCATTTGTAATAATTTTCTTCATAGTAATACCTATTATAATTGGGGGATTCGGTAATTGACTGGTTCCACTAATAATCGGAGCACCAGATATAGCTTTTCCACGAATAAATAACATAAGTTTTTGACTTTTACCACCATCATTAACTCTTTTAATTGCATCATCAATAGTAGATAATGGTGCAGGAACAGGATGAACAGTTTATCCCCCTCTCGCAGGAGCAATCGCACATGGAGGAGGATCAGTAGACCTGGCTATTTTTTCATTACATTTAGCAGGTGTTTCATCAATTTTAGGAGCAGTTAATTTCATTACAACTGCAATCAATATACGGTCGGAAAGAATAACACTAGATCAAACACCACTATTTGTCTGATCAGTAGCAATTACAGCACTCCTATTACTATTATCATTACCGGTACTAGCAGGAGCAATTACTATATTATTAACTGATCGAAATTTAAATACTTCGTTCTTTGACCCCGCAGGTGGTGGAGATCCAATCCTTTATCAACATTTATTTTGATTTTTTGGTCACCTGGAG,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C010.fasta,,
"",47.2300000000,8.3200000000,09/28/2020,"
\n- Collected from the road<\/li>\n
- Autumn<\/li>\n
- 15\u00b0C<\/li>\n
- Elevation \u2013 460<\/li>\n<\/ul>\n",Pentatoma rufipes,Wizard SV (Promega),,,,,"","",No,TATATGAGCAGGTATAGTAGGATCAGCTATAAGTATTATTATTCGAATTGAATTAGGTCAACCCGGAAGATTTATTGGAGATGATCAAATTTATAATGTTGTAGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATGCCAATTATAATTGGTGGGTTTGGAAATTGACTAGTACCTTTAATAATTGGAGCACCTGATATAGCCTTTCCACGAATAAATAATATAAGATTTTGATTATTACCCCCTTCATTAACATTATTAATAATAAGAAGATTAACAGAAGCTGGAGCTGGTACTGGCTGAACAGTTTACCCCCCTTTATCTAGAAATTTATCACACAGAGGAACTTCAGTAGAYTTAGCTATTTTTTCTCTTCATTTAGCAGGGGTTTCTTCAATTTTAGGTGCAGTAAATTTCATTTCAACAATTATAAATATACGCCCAACTGGAATAACTCCCGAGCGAATTCCTCTATTCGTTTGATCTGTTGGAATTACAGCTTTACTTTTATTGTTATCACTACCAGTATTAGCTGGAGCTATTACAATATTATTAACAGATCGAAATTTTAATACATCATTTTTTGACCCCTCAGGGGGTGGGGATCCCATTCTTTATCAACATTTATTTTGATTTTTTGGTCACCCTGGAAAGTTTA,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C009.fasta,,
"",47.24,8.31,09/28/2020,"
\n- Collected from grass, field (terrestrial)<\/li>\n
- Autumn<\/li>\n
- 15\u00b0C<\/li>\n
- Elevation \u2013 571<\/li>\n<\/ul>\n",Orthoptera,Wizard SV (Promega),,,,,"","",Yes,ATGAGCTGGATAGTAGGTACATCAATAAGAATAATTATTCGTGCAGAACTTGGACAACCAGGATCCATAATTGGAGATGATCAAATCTATAATGTTATTATTACAGCACATGCATTTGTAATAATTTTCTTCATAGTAATACCTATTATAATTGGAGGATTCGGTAATTGACTGGTTCCACTAATAATCGGAGCACCAGATATAGCTTTTCCACGAATAAATAACATAAGTTTTTGACTTTTACCACCATCATTAACTCTTTTAATTGCATCATCAATAGTAGATAATGGTGCAGGAACAGGATGAACAGTTTATCCCCCTCTCGCAGGAGCAATCGCACATGGAGGAGGATCAGTAGACCTGGCTATTTTTTCATTACATTTAGCAGGTGTTTCATCAATTTTAGGAGCAGTTAATTTCATTACAACTGCAATCAATATACGGTCGGAAAGAATAACACTAGATCAAACACCACTATTTGTCTGATCAGTAGCAATTACAGCACTCCTATTACTATTATCATTACCGGTACTAGCAGGAGCAATTACTATATTATTAACTGATCGAAATTTAAATACTTCGTTCTTTGACCCTGCGGGTGGTGGAGATCCAATCCTTTATCAACATTTATTTTGATTTTTTGGTCACCCTGGAAGTTTAATC,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C008.fasta,,
"",47.2400000000,8.3100000000,09/28/2020,"
\n- Collected from forest (terrestrial)<\/li>\n
- Autumn<\/li>\n
- 15\u00b0C<\/li>\n
- Elevation \u2013 571<\/li>\n<\/ul>\n",Harmonia axyridis,Wizard SV (Promega),,,,,"","",No,GGAATAGTAGGAACATCGTTAAGTATTTTAATTCGGTTAGAATTAGGAACTAGAGGAAGATTAATTGGAAACGACCAAATTTATAATATAATTGTTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTAATACCTATTATAATTGGGGGTTTTGGAAATTGATTA,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C006.fasta,,
"",47.2400000000,8.3100000000,09/28/2020,"
\n- Terrestrial<\/li>\n
- Autumn<\/li>\n
- 15\u00b0C<\/li>\n
- Elevation \u2013 571<\/li>\n<\/ul>\n",Nezara viridula,Wizard SV (Promega),,,,,"","",No,GAGCAGGATAGTAGGATCAGCAATAAGATTAATTATTCGAATTGAACTAGGACAACCCGGAAGATTTATTGGAGATGATCAAATTTATAATGTAGTAGTAACAGCTCACGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATAATTGGTGCTCCAGATATAGCATTCCCTCGAATAAACAATATAAGATTCTGGYTATTACCCCCATCATTAACCCTTTTAATAGTAAGAAGATTAGCAGAATCTGGAGCAGGAACAGGATGAACTGTTTATCCTCCTTTATCTAGTAATTTATCTCATAGAGGAGCCTCAGTGGATTTAGCTATTTTTTCATTACATCTAGCAGGAGTATCATCAATCTTAGGCGCAGTAAATTTCATTTCAACTATTATTAATATACGACCAACAGGTATAACTCCAGAACGAGTTCCACTATTTGTTTGATCAGTTGGGATCACAGCATTATTATTACTACTTTCATTACCTGTACTAGCAGGTGCAATTACAATATTATTAACAGATCGGAACTTTAATACATCATTCTTTGACCCTTCAGGAGGGGGAGATCCCATTCTTTATCAACACTTATTTTGATTTTTTGGTCACCCTGAAAGTTTAAAA,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C005.fasta,,
"",47.2300000000,8.3200000000,,"
\n- Collected from dark, dry area, under a building<\/li>\n
- Autumn<\/li>\n
- 15\u00b0C<\/li>\n
- Elevation \u2013 460<\/li>\n<\/ul>\n",Pyrrhocoris apterus,Wizard SV (Promega),,,,,"","",No,GGTATATGATCAGGAATAATTGGATCCTCAATAAGTTGAATTATTCGAGTAGAACTAGGACAACCTGGAACCTTTATTGGAGATGATCAAATTTATAATGTAATCGTCACAGCACATGCTTTCATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGCAATTGATTAGTTCCTTTAATAATTGGAGCACCAGATATAGCTTTTCCTCGCATAAATAATATAAGATTTTGACTTTTACCACCCTCTCTAACTCTATTAATCTCCAGTAGCATAGTAGAAATAGGAGCAGGAACTGGTTGAACAGTTTACCCGCCTTTATCTAGTAATATCTCACATAGAGGACCTTCAGTAGATTTAGCAATCTTTTCATTACATTTAGCAGGAGTTTCTTCAATTCTAGGAGCAGTTAATTTTATTTCAACAATTATTAACATACGACCTATAGGGATAACTCTTGAACGAACACCATTATTTGTTTGATCAGTAGGAATTACTGCTTTATTATTACTTTTATCATTACCAGTTCTAGCAGGAGCCATTACAATACTATTAACTGATCGAAATTTTAATACCTCTTTCTTTGACCCTACAGGAGGAGGAGACCCAATTCTTTATCAACATCTATTTTGATTTTTTGGTCACCGGGGAA,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C004.fasta,,
"",47.2400000000,8.3200000000,09/28/2020,"
\n- Collected from forest, air<\/li>\n
- Autumn<\/li>\n
- 15\u00b0C<\/li>\n
- Elevation \u2013 460<\/li>\n<\/ul>\n",Athalia cordata,Wizard SV (Promega),,,,,"","",No,CAGGATACTTGGACTATCACTAAGCATGATTATCCGAAGAGAATTAAGATCAGCAAATTCACTTATTAATAATGATCAAGTTTATAACGTAATTGTTACATCTCACGCTTTCTTAATAATTTTCTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCATTAATATTAGGAGCACCCGATATAGCATTCCCACGAATAAATAATATAAGATTCTGATTTTTACCTCCATCCCTAATTCTACTTCTTTCAAGAAGAATAGTAAACACTGGATCTGGAACAGGGTGAACAGTTTATCCACCATTATCCTCAAATACCTCCCATGCTGGAGCATCTGTTGATTTAACAATTTTTTCATTACATTTAGCAGGTATTTCTTCCATTTTAGGAGCTATTAACTTTATTTCTACTATTTTAAATATACGAATAAATGGTATAACAAACGAACGAATAAGTTTATTCACATGATCAGTATTATTAACAGCTATTTTATTATTATTATCATTACCAGTGCTAGCAGGAGCAATTACAATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCTTCTGGAGGTGGAGACCCCATTCTATATCAACATCTATTTTGATTTTTTGGTCAC,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C003.fasta,,
"",47.2400000000,8.3100000000,09/28/2020,"
\n- Collected from grass, field (terrestrial)<\/li>\n
- Autumn<\/li>\n
- 15\u00b0C<\/li>\n
- Elevation \u2013 571<\/li>\n<\/ul>\n",Voria ruralis,Wizard SV (Promega),,,,,"","",No,AGGATAGTAGGAACATCCCTTAGAATATTAATTCGATTTGAATTAGGTCATCCAGGAGCCTTAATTGGTAATGATCAAACATACAATGTTATCGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTCTTATACTAGGAGCTCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGATTACTTCCTCCTTCACTAACATTATTATTGATAAGAAGAATGGTTGAAAACGGAGCTGGAACAGGATGAACTGTTTATCCACCTTTATCATCTAATATTGCTCATAGAGGATCTTCTGTTGATTTAGCTATTTTTTCATTACATTTAGCTGGAATTTCATCAATTTTGGGAGCTGTAAATTTTATTACTACAGTAATTAATATACGATCTGTAGGAATTACATTTGATCGAATACCATTATTTGTTTGATCAGTAGTAATTACTGCATTATTACTTTTATTATCATTACCCGTATTAGCTGGAGCTATTACTATACTATTAACAGATCGAAATTTTAATACTTCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTTTGATTTTTTGGTCAC,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C002.fasta,,
"",47.2400000000,8.3100000000,09/28/2020,"
\n- Collected from grass, field (terrestrial)<\/li>\n
- Autumn<\/li>\n
- 15\u00b0C<\/li>\n
- Elevation – 571<\/li>\n<\/ul>\n",Nezara viridula,Wizard SV (Promega),,,,,"","",No,TATGAGCAGGAATAGTAGGATCAGCAATAAGATTAATTATTCGAATTGAACTAGGACAACCCGGAAGATTTATTGGAGATGATCAAATTTATAATGTAGTAGTAACAGCTCACGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATAATTGGTGCTCCAGATATAGCATTCCCTCGAATAAACAATATAAGATTCTGGTTATTACCCCCATCATTAACCCTTTTAATAGTAAGAAGATTAGCAGAATCTGGAGCAGGAACAGGATGAACTGTTTATCCTCCTTTATCTAGTAATTTATCTCATAGAGGAGCCTCAGTGGATTTAGCTATTTTTTCATTACATCTAGCAGGAGTATCATCAATCTTAGGCGCAGTAAATTTCATTTCAACTATTATTAATATACGACCAACAGGTATAACTCCAGAACGAGTTCCACTATTTGTTTGATCAGTTGGGATCACAGCATTATTATTACTACTTTCATTACCTGTACTAGCAGGTGCAATTACAATATTATTAACAGATCGGAACTTTAATACATCATTCTTTGACCCTTCAGGAGGGGGAGATCCCATTCTTTATCAACACTTATTTTGATTTTTTGGTCACCTGGGAAA,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/EDU150_C001.fasta,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG_1515.jpg,",36.0802326,-86.8320743,09/24/2020,"
Black\/very dark brown. Wings. 6 long legs\/limbs. 2 limbs are striped.<\/p>\n",Culicidae,,Partial abdomen,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/2528A369-A969-4487-8412-1B0F5539FBE8-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/7B0D2CB7-15CC-4E6B-8F63-BACBE0159D77-scaled.jpeg,",36.2754942000,-86.8320743000,09/25/2020," I found this ant in my back yard behind some rocks. The temperature kind of felt humid that day, if I had to guess the temperature I would say it was around 70-75 degrees F. When collecting the ant it seemed to be slower than most but it was able to dodge my trap by weaving through the rocks.<\/p>\n",Insecta,Edwards Buffer,Abdomen,,,,""," For the DNA extraction part of this I sent the insect into a lab and so far I haven\u2019t gotten back any results.<\/p>\n",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/ant-on-wood.jpg,",36.1020038000,-87.1150054000,09/24/2020," I collected this ant from under old damp wood. There were many more ants in this environment along with many other insect species. This ant was collected at around 5:30 pm and it was in the lower 70s outside.<\/p>\n",Formicidae,DNeasy (Qiagen),Abdomen,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/Screenshot-2020-11-12-145209.png,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/ant-on-glass.jpg,",36.10200380000001,-87.1150054,09/24/2020," I collected this ant from under old wet pieces of wood found in the woods. I collected this ant at around 6 pm and it was in the lower 70s outside. There was an abundance of these ants along with others in this environment.<\/p>\n",Formicidae,DNeasy (Qiagen),Whole arthropod,,,,"","",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/pill-bug.jpg,",36.1020038000,-87.1150054000,09/24/2020," I found this pill bug\/rolly polly under a wet flower pot. It was collected in the mid-afternoon around 4:20 pm. It was in the higher 60s lower 70s outside. There were lots of rolly pollies in this area, as well as under wet leaves and old wood.<\/p>\n",Armadillidae,DNeasy (Qiagen),Whole arthropod,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/Screenshot-2020-11-12-145209-1.png,","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/IMG-0416-scaled.jpeg,",36.0734056825,-86.7488168042,09/24/2020," The Red-banded Fungus Beetle was living in a tree stump with many of its same variety. I collected 5 of these. It was completely submerged in the wood, which was damp. It’s overall environment was dark. It was collected at 5:30 pm and the temperature outside was about 70 degrees.<\/p>\n",Megalodacne,Puregene (Qiagen),Partial abdomen,Standard electrophoresis system,TAE,,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/Screenshot-45.png,"," The beetle had a lot of protein, which was noted during the processing.<\/p>\n I assume that this fact may have something to due with the way that the bands appeared. They were very faded and some bands did not appear at all. Along with that, Ms. Lemon mentioned how the hard exoskeleton of the beetle made the gel electrophoreses process a tad bit difficult, so therefore that is more than likely another reason that the bands had trouble appearing.<\/p>\n",No,,,,
"",38.0001790000,-98.7445459000,08/14/2020," I found these Spotted Cucumber beetles on sunflowers. Before I preserved them in 70% ethanol they were a bright yellow and they blended in with the flowers really well. There were also Soldier beetles on the same sunflowers and blended in as well.<\/p>\n",Coleoptera,DNeasy (Qiagen),Abdomen,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/11/Wolbachia-Project-1.jpg,"," The beetle was stored in 90% ethanol for about a month before extraction.<\/p>\n DNA Extraction: The DNA was extracted from the abdomen. All of the Dneasy (Qiagen) protocols were followed. The extraction took several days to complete.<\/p>\n PCR: Mini One Taq polymerase was used.<\/p>\n Gel Electropheresis: All of the lanes worked except for the DNA ladder. When pipetting, the well was missed and had to be done again which might have been the reason.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/8e.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/8d.jpg,",36.0497919174,-86.8985396502,08/30/2020," This milkweed bug is likely a nymph as it doesn’t look fully developed and was unable to fly. It was collected directly from a milkweed plant in an open field. A collection vial was quickly placed over top and immediately capped with a lid. The bug was then carefully tapped into a tube of 70% ethanol. There were also oleander aphids and small ants on the same plant.<\/p>\n",Oncopeltus fasciatus,DNeasy (Qiagen),Partial abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Screen-Shot-2020-09-20-at-8.08.20-PM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Screen-Shot-2020-09-20-at-8.08.13-PM.png,"," The milkweed bug was stored in 70% ethanol for about 3 weeks prior to DNA extraction.<\/p>\n DNA Extraction: DNA was extracted from very tip of abdomen (about 1\/3). The specimen was incubated in lysis buffer at 56C for 2 hours. Because there was cell debris, I did a 30 sec spin and transferred the supernatant to a fresh tube of 200ul ethanol. This was placed in the freezer overnight and purified the following day. Eluted DNA was immediately incubated at 65C for one hour prior to PCR.<\/p>\n PCR: MiniOne Taq polymerase was used.<\/p>\n Gel electrophoresis: The arthropod gel looks whispy; however, that went away as the gel ran longer. This could have been caused by not adding loading dye to samples. The results were very clear, though. I re-colored the gel images in PowerPoint. The MiniOne ladder contains 5 bands: 100, 300, 500, 1000, and 2000 bp.<\/p>\n",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/6h.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/6c.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/6d.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/6a.jpg,",36.0490913328,-86.8996113131,08/30/2020," This ladybird beetle was located on a milkweed plant. It was a bright sunny day and 80F.\u00a0 The beetle is presumably female as a male was trying to mate with her. She was a bright red color, but the pigmentation was diluted during ethanol preservation. She was collected directly from the milkweed plant by quickly placing a collection vial over top and immediately capping with a lid.<\/p>\n",Harmonia axyridis,DNeasy (Qiagen),Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Screen-Shot-2020-09-20-at-8.05.50-PM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Screen-Shot-2020-09-20-at-8.05.43-PM.png,"," The beetle was stored in 70% ethanol at room temperature for about 3 weeks prior to DNA extraction.<\/p>\n DNA Extraction: DNA was extracted from the entire abdomen. It was likely too large because it created a thick slurry during lysis. The specimen was incubated in lysis buffer at 56C for 2 hours. Because there was cell debris, I did a 30 sec spin and transferred the supernatant to a fresh tube of 200ul ethanol. This was placed in the freezer overnight and DNA was purified the following day. Eluted DNA was immediately incubated at 65C for one hour prior to PCR.<\/p>\n PCR: MiniOne Taq polymerase was used.<\/p>\n Gel electrophoresis: The arthropod gel looks whispy; however, that went away as the gel ran longer. This could have been caused by not adding loading dye to samples. The results were very clear, though. I re-colored the gel images in PowerPoint. The MiniOne ladder contains 5 bands: 100, 300, 500, 1000, and 2000 bp.<\/p>\n",Yes,AGTAGGAACATCGTTAAGTATTTTAATTCGGTTAGAATTAGGAACTAGAGGAAGATTAATTGGAAACGACCAAATTTATAATATAATTGTTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTAATACCTATTATAATTGGGGGTTTTGGAAATTGATTAGTTCCTTTAATAATTGGAGCTCCTGATATAGCATTTCCACGATTAAATAACATAAGATTTTGACTTTTACCCCCTGCTTTAACTCTTTTAATTTTAAGAACAATCGTAGAAATAGGGGCAGGAACAGGATGAACTGTTTACCCTCCTCTTTCTTCTAATTTAACACATAATGGGCCTTCAGTAGATTTAGTGATTTTTAGTTTACATTTAGCAGGAATTTCCTCAATTTTAGGTGCAGTAAATTTCATTTCAACTATTATAAATATACGTCCATTTGGTATAATACTTGATAAAACTCCTTTATTTGTATGATCTGTTCTTATTACAGCAATTCTTTTATTACTATCACTACCAGTTCTTGCAGGAGCAATTACTATACTATTAACTGACCGAAACTTAAATTCTTCTTTTTTTGACCCAACCGGTGGGGGAGACCCAATTTTATACCAACATTT,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Ladybird-Arthropod_F.fasta,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/5c.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/5a.jpg,",36.0482371606,-86.9010671121,08/30/2020," I was walking through a wildflower park near Edwin Warner Park in Nashville, TN and this sweat bee landed on my arm. It was collected by quickly placing a collection vial over the bee and immediately capping with a lid. It was about 80F and very sunny.<\/p>\n",Lasioglossum,DNeasy (Qiagen),Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Screen-Shot-2020-09-20-at-8.05.02-PM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Screen-Shot-2020-09-20-at-8.04.55-PM.png,"," This sweat bee was stored in 70% ethanol for about 3 weeks prior to DNA extraction.<\/p>\n DNA Extraction: The specimen was incubated in lysis buffer at 56C for 2 hours. Because there was cell debris, I did a 30 sec spin and transferred the supernatant to a fresh tube of 200ul ethanol. This was placed in the freezer overnight and DNA was purified the following day. Eluted DNA was immediately incubated at 65C for one hour prior to PCR.<\/p>\n PCR: MiniOne Taq polymerase was used.<\/p>\n Gel electrophoresis: The arthropod gel looks whispy; however, that went away as the gel ran longer. This could have been caused by not adding loading dye to samples. The results were very clear, though. I re-colored the gel images in PowerPoint. The MiniOne ladder contains 5 bands: 100, 300, 500, 1000, and 2000 bp.<\/p>\n",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/4c-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/4d-2.jpg,",36.1626638000,-86.7816016000,08/30/2020," This blowfly was buzzing around my patio, landed in my glass of water, and drowned. It was collected by using forceps to pull out of the water.<\/p>\n",Lucilia cuprina,DNeasy (Qiagen),Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Screen-Shot-2020-09-20-at-8.02.10-PM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Screen-Shot-2020-09-20-at-8.02.02-PM.png,"," The fly was stored in 70% ethanol at room temperature for about 3 weeks prior to DNA extraction.<\/p>\n DNA Extraction: The fly was incubated in lysis buffer at 56C for 2 hours. Because there was cell debris, I did a 30 sec spin and transferred the supernatant to a fresh tube of 200ul ethanol. This was placed in the freezer overnight and DNA was purified the following day. Eluted DNA was immediately incubated at 65C for one hour prior to PCR.<\/p>\n PCR: MiniOne Taq polymerase was used.<\/p>\n Gel electrophoresis: The arthropod gel looks whispy; however, that went away as the gel ran longer. This could have been caused by not adding loading dye to samples. The results were very clear, though. I re-colored the gel images in PowerPoint. The MiniOne ladder contains 5 bands: 100, 300, 500, 1000, and 2000 bp. This sample was labeled as “blowfly”<\/p>\n",No,AATTGGAACTTCTTTAAGAATTCTAATTCGAGCTGAATTAGGACACCCTGGAGCTTTAATTGGAGATGATCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATACTAGGAGCTCCAGATATAGCATTCCCTCGAATAAATAATATAAGTTTTTGACTTTTACCTCCTGCATTAACTTTATTATTAGTTAGTAGTATAGTAGAAAACGGAGCTGGAACAGGATGAACAGTTTACCCTCCCCTATCTTCTAATATTGCTCATGGAGGAGCTTCTGTTGATTTAGCTATTTTCTCTCTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCTGTAAATTTTATTACTACAGTTATTAATATACGATCAACAGGAATTACTTTTGATCGAATACCTTTATTTGTTTGATCAGTAGTAATTACAGCTTTATTGCTTTTATTATCATTACCAGTATTAGCAGGAGCTATTACAATACTTTTAACAGACCGAAATCTTAATACATCATTCTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTTT,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Blowfly-Arthropod_F.fasta,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/3d-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/3e.jpg,",36.0561223999,-86.9083882044,08/30/2020," A colony of black ants appeared to be living within the tree bark. One was collected at 11:50 am by placing a collection vial over top and allowing it to climb up.. The temperature was 78F, slightly cloudy, and 85% humidity. It is likely a carpenter ant.<\/p>\n",Camponotus pennsylvanicus,DNeasy (Qiagen),Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Screen-Shot-2020-09-20-at-7.59.07-PM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Screen-Shot-2020-09-20-at-7.59.00-PM.png,"," This sample was labeled as carpenter ant in the gel.<\/p>\n The ant was stored in 70% ethanol for about 3 weeks prior to DNA extraction.<\/p>\n DNA Extraction: The ant was incubated in lysis buffer at 56C for 2 hours. Because there was cell debris, I did a 30 sec spin and transferred the supernatant to a fresh tube of 200ul ethanol. This was placed in the freezer overnight and DNA was purified the following day. Eluted DNA was immediately incubated at 65C for one hour prior to PCR.<\/p>\n PCR: MiniOne Taq polymerase was used.<\/p>\n Gel electrophoresis: The arthropod gel looks whispy; however, that went away as the gel ran longer. This could have been caused by not adding loading dye to samples. The results were very clear, though. I re-colored the gel images in PowerPoint. The MiniOne ladder contains 5 bands: 100, 300, 500, 1000, and 2000 bp.<\/p>\n",Yes,AATTGGCTCCTCTATAAGAATAATCATTCGACTAGAGTTAGGATCTCCTGATTCACTAATTCTTAATGATCAAACTTTCAATACCATCGTTACAAGTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTTTTATAATTGGGGGATTTGGTAATTTTTTAATTCCACTTATACTAGGATCTCCTGATATAGCTTACCCTCGTTTAAATAACATAAGATTTTGATTACTTCCCCCATCGATCTCCTTATTAATCCTAAGAAATTTTATTAATGAAGGATCTGGAACTGGTTGAACTATCTACCCCCCTCTATCATCAAATACCTTCCATAGTGGCCCCTCTATTGACCTGACTATCTTTTCTCTCCATATTGCTGGTATATCCTCAATTATAGGAGCAATCAATTTTATTTCAACAATTATAAATATACATAATTCCAATATTTCCCTAGATAAAATTCCCTTATTAGTATGATCTATTCTTATTACAGCTATTCTCCTTCTTCTGTCCCTACCTGTTCTAGCAGGCGCTATTACAATACTACTAACAGACCGAAATCTTAATACTTCATTTTTCGATCCCTCGGG,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/CarpenterAnt-Arthropod_F.fasta,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/2a-scaled.jpg,",36.0555258703,-86.9088502504,08/30/2020," This medium sized ant was crawling across a paved walking trail. It was moving so fast that I was unable to capture a live action picture. It was collected by placing a collection vial over top and allowing it to climb up. The ant has a black head, amber-colored thorax and legs, and a black abdomen. It was collected at 11:45am. 78F, 85% humidity, slightly cloudy.<\/p>\n",Camponotus chromaiodes,DNeasy (Qiagen),Abdomen,MiniOne,TBE,,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Screen-Shot-2020-09-20-at-7.55.17-PM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Screen-Shot-2020-09-20-at-7.55.09-PM.png,"," The ant was stored in 70% ethanol at room temperature for about 3 weeks prior to DNA extraction.<\/p>\n DNA Extraction: The ant was incubated in lysis buffer at 56C for 2 hours. Because there was cell debris, I did a 30 sec spin and transferred the supernatant to a fresh tube of 200ul ethanol. This was placed in the freezer overnight and DNA was purified the following day. Eluted DNA was immediately incubated at 65C for one hour prior to PCR.<\/p>\n PCR: MiniOne Taq polymerase was used.<\/p>\n Gel electrophoresis: The arthropod gel looks whispy; however, that went away as the gel ran longer. This could have been caused by not adding loading dye to samples. The results were very clear, though. I re-colored the gel images in PowerPoint. The MiniOne ladder contains 5 bands: 100, 300, 500, 1000, and 2000 bp.<\/p>\n",Yes,AGTTGGCTCCTCTATAAGAATAATCATTCGACTAGAGTTGGGATCTCCTGATTCACTAATTCTTAATGATCAAACTTTCAATACCATCGTTACAAGTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTTTTATAATTGGGGGATTTGGTAATTTTTTAATTCCCCTTATACTAGGATCTCCTGATATAGCTTACCCCCGTTTAAATAACATAAGATTTTGATTACTTCCCCCATCGATCTCCTTATTAATCCTAAGAAATTTTATTAATGAAGGATCTGGAACTGGTTGGACTGTCTACCCCCCTCTATCATCAAATACCTTCCATAGTGGCCCCTCTATTGACCTGACTATCTTTTCTCTCCATATTGCTGGTATATCCTCAATTATAGGAGCAATCAATTTTATTTCAACAATTATAAATATACATAATTCCAATATTTCCCTAGATAAAATTCCCTTATTAGTATGGTCTATTCTTATTACAGCTATTCTCCTTCTTCTGTCCCTACCTGTTCTAGCAGGAGCTATTACAATACTACTAACAGACCGAAATCTTAATACTTCATTTTTCGACCCTTCGGGAGGGGGAGA,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Ant-Arthropod_F.fasta,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/1a-scaled.jpg,",36.0727326000,-86.9624086000,08/26/2020," Dozens of small ants were scurrying across the cement at a neighborhood swimming pool. One ant was collected at 3:15pm by placing a collection vial over top and allowing it to climb up. It was a cloudy day, 83F, 66% humidity.<\/p>\n",Lasius alienus,DNeasy (Qiagen),Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Screen-Shot-2020-09-20-at-7.49.27-PM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Screen-Shot-2020-09-20-at-7.49.18-PM.png,"," This sample is labeled as “small ant” on the above gels.<\/p>\n The ant was stored in 70% ethanol at room temp for about 3 weeks prior to DNA extraction.<\/p>\n DNA Extraction: The ant was incubated in lysis buffer at 56C for 2 hours. Because there was cell debris, I did a 30 sec spin and transferred the supernatant to a fresh tube of 200ul ethanol. This was placed in the freezer overnight and DNA was purified the following day. Eluted DNA was immediately incubated at 65C for one hour prior to PCR.<\/p>\n PCR: MiniOne Taq polymerase was used.<\/p>\n Gel electrophoresis: The arthropod gel looks whispy; however, that went away as the gel ran longer. This could have been caused by not adding loading dye to samples. The results were very clear, though. I re-colored the gel images in PowerPoint. The MiniOne ladder contains 5 bands: 100, 300, 500, 1000, and 2000 bp.<\/p>\n",No,TTGAGCTGGTATAATTGGCTCATCTATAAGAATAATTATCCGACTAGAATTAGGTTCATCTAATTCATTAATTAATAATGATCAAATTTATAACTCTATAGTTACAAGGCACGCATTTGTTATAATTTTCTTCATAGTTATACCTTTCATAATTGGTGGATTTGGTAATTTTCTTGTACCTTTAATATTAGGTTCACCTGATATGGCTTACCCCCGTATAAATAATATAAGATTTTGACTTTTACCTCCCTCTATTTCTCTACTCCTTTTAAGAAATTTCATTAATGATGGAGTCGGAACAGGATGAACCGTTTATCCTCCTTTAGCCTCAAATATCTTCCATAATGGCCCTTCAGTTGATTTAACTATTTTCTCTCTTCACATCGCTGGAATATCTTCTATTTTAGGAGCTATTAATTTTATTTCAACTATTATAAACATACACCATAAAAATTTTTCTATTGATAAAATTCCACTACTTGTATGATCAATCTTAATTACTGCAATTTTACTACTTCTATCCCTTCCTGTTCTTGCAGGAGCTATTACTATACTTTTAACTGACCGTAACCTTAATACTTCATTTTTTGACCCATCAGGAGGTGG,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/SmallAnt-Arthropod_F.fasta,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/7f.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/7h.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/7b.jpg,",36.0491315201,-86.8980705390,08/30/2020," These aphids were collected directly from a milkweed plant by scraping into a tube filled with 70% ethanol. It was a bright and sunny day, 80F. There were small ants and a milkweed bug on the same plant.<\/p>\n",Aphis nerii,DNeasy (Qiagen),Whole arthropod,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Screen-Shot-2020-09-20-at-7.37.32-PM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Screen-Shot-2020-09-20-at-7.39.49-PM.png,"," The aphids were stored in 70% ethanol for about 3 weeks prior to DNA extraction. They were highly desiccated.<\/p>\n DNA Extraction: DNA was extracted from four adults. They were incubated in lysis buffer at 56C for 2 hours. Following incubation, I did a 30 sec spin and transferred the supernatant to a fresh tube of 200ul ethanol. This was placed in the freezer overnight and purified the following day. Eluted DNA was immediately incubated at 65C for one hour prior to PCR.<\/p>\n PCR: MiniOne Taq polymerase was used.<\/p>\n Gel electrophoresis: The arthropod gel looks whispy; however, that went away as the gel ran longer. This could have been caused by not adding loading dye to samples. The results were very clear, though. I re-colored the gel images in PowerPoint. The MiniOne ladder contains 5 bands: 100, 300, 500, 1000, and 2000 bp.<\/p>\n",No,GGTATAATCGGATCTTCTCTTAGAATTTTAATTCGACTAGAATTAAGTCAAATTAATTCAATTATTAATAATAATCAATTATATAATGTAATTGTTACAATTCATGCTTTCATTATAATTTTTTTTATAACAATACCAATTGTAATTGGAGGATTTGGAAACTGGTTAATTCCTATAATAATAGGATGTCCAGATATATCTTTTCCACGATTAAATAATATTAGATTTTGATTATTACCTCCATCTTTAATAATAATAATTTGTAGTTTTATAATTAATAATGGAACAGGAACAGGATGAACAATTTATCCACCTTTATCAAATAACATTGCTCATAATAATATCTCAGTTGATTTAACTATTTTTTCTCTTCACTTAGCAGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTTGTACAATCCTAAACATAATACCTAATAATATAAAATTAAATCAAATTCCTCTATTTCCATGATCAATTTTAATTACAGCTATACTATTAATTTTATCTTTACCAGTATTAGCTGGTGCAATTACTATACTATTAACTGATCGAAATCTAAATACATCATTTTTTGACCCAGCAGGAGGGGGTGATCCTATCCTTTATCAACATTTATTTTGA,https://wolbachiaprojectdb.org/wp-content/uploads/2020/09/Aphid_706-Arthropod_F.fasta,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2020/06/tconfusum.jpeg,",33.9446470000,-84.3226488000,06/02/2020," Beetle samples from a culture from Josh’s Frogs herp site. trying to establish a working culture for further research.<\/p>\n Gel Pic Below: Lanes 2-5 are T. confusum beetles. Lane 1 is positive W control and lane 9 negative W control.<\/p>\n",Insecta,,Whole arthropod,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2020/06/IMG_8705-1-scaled.jpeg,"," Wspec primers.<\/p>\n",Yes,,,,
"",47.3031293000,9.0880638000,05/30/2020," Sample 92<\/p>\n",Phaonia angelicae,,,,,,"","",Yes,TTTTTGGTGCTTGATCAGGAATAGTAGGAACTTCACTAAGTATTCTAATTCGAGCCGAATTAGGACACCCTGGAGCTTTAATTGGAGATGATCAAATTTATAATGTAATCGTAACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTGCCCCTAATATTAGGAGCCCCAGACATAGCCTTTCCTCGAATAAATAATATGAGATTTTGACTTTTACCTCCTGCTTTAACATTGCTGCTAACTAGCAGCATAGTAGAAACTGGAGCTGGAACAGGATGAACTGTTTACCCCCCACTATCATCTAATATTGCTCATGGAGGAGCCTCTGTTGATTTAGCTATTTTTTCCCTTCATTTAGCAGGAATCTCCTCTATTCTAGGAGCCGTAAATTTTATTACAACTGTAATTAATATACGATCAATAGGAATTACATTCGATCGCATACCTTTATTTGTATGATCAGTAGTAATTACAGCTTTATTATTACTTTTATCATTACCTGTTTTA,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/RA92-M13F.fasta,,
"",47.3031293000,9.0880638000,05/30/2020," Sample 90<\/p>\n",Phaonia angelicae,,,,,,"","",Yes,TTTTTGGTGCTTGATCAGGAATAGTAGGAACTTCACTAAGTATTCTAATTCGAGCCGAATTAGGACACCCTGGAGCTTTAATTGGAGATGATCAAATTTATAATGTAATCGTAACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTGCCCCTAATATTAGGAGCCCCAGACATAGCCTTTCCTCGAATAAATAATATGAGATTTTGACTTTTACCTCCTGCTTTAACATTGCTGCTAACTAGCAGCATAGTAGAAACTGGAGCTGGAACAGGATGAACTGTTTACCCCCCACTATCATCTAATATTGCTCATGGAGGAGCCTCTGTTGATTTAGCTATTTTTTCCCTTCATTTAGCAGGAATCTCCTCTATTCTAGGAGCCGTAAATTTTATTACAACTGTAATTAATATACGATCAATAGGAATTACATTCGATCGCATACCTTTATTTGTATGATCAGTAGTAATTACAGCTTTATTATTACTTTTATCATTACCTGTTTTAGCAGGAGCTATTACAATATTATTGACAGATCGAAATTTAAATACATCTTTTTTTGACCCTGCAGGAGGAGGAGATCCAGTATTATACCAGCATTTATTTTGATTTTTTG,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/RA90-M13F.fasta,,
"",47.3031293000,9.0880638000,01/09/2019," Sample 88<\/p>\n",Phaonia angelicae,,,,,,"","",Yes,TTTTTGGTGCTTGATCAGGAATAGTAGGAACTTCACTAAGTATTCTAATTCGAGCCGAATTAGGACACCCTGGAGCTTTAATTGGAGATGATCAAATTTATAATGTAATCGTAACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTGCCCCTAATATTAGGAGCCCCAGACATAGCCTTTCCTCGAATAAATAATATGAGATTTTGACTTTTACCTCCTGCTTTAACATTGCTGCTAACTAGCAGCATAGTAGAAACTGGAGCTGGAACAGGATGAACTGTTTACCCCCCACTATCATCTAATATTGCTCATGGAGGAGCCTCTGTTGATTTAGCTATTTTTTCCCTTCATTTAGCAGGAATCTCCTCTATTCTAGGAGCCGTAAATTTTATTACAACTGTAATTAATATACGATCAATAGGAATTACATTCGATCGCATACCTTTATTTGTATGATCAGTAGTAATTACAGCTTTATTATTACTTTTATCATTACCTGTTTTAGCAGGAGCTATTACAATATTATTGACAGATCGAAATTTAAATACATCTTT,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/RA88-M13F.fasta,,
"",,,," Sample 75<\/p>\n",Phaonia angelicae,,,,,,"","",Yes,TTTTTGGTGCTTGATCAGGAATAGTAGGAACTTCACTAAGTATTCTAATTCGAGCCGAATTAGGACACCCTGGAGCTTTAATTGGAGATGATCAAATTTATAATGTAATCGTAACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTGCCCCTAATATTAGGAGCCCCAGACATAGCCTTTCCTCGAATAAATAATATGAGATTTTGACTTTTACCTCCTGCTTTAACATTGCTGCTAACTAGCAGCATAGTAGAAACTGGAGCTGGAACAGGATGAACTGTTTACCCCCCACTATCATCTAATATTGCTCATGGAGGAGCCTCTGTTGATTTAGCTATTTTTTCCCTTCATTTAGCAGGAATCTCCTCTATTCTAGGAGCCGTAAATTTTATTACAACTGTAATTAATATACGATCAATAGGAATTACATTCGATCGCATACCTTTATTTGTATGATCAGTAGTAATTACAGCTTTATTATTACTTTTATCATTACCTGTTTTAGCAGGAGCTATTACAATATTATTGACAGATCGAAATTTAAATACATCTTTTTTTGACCCTGC,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/RA75-M13F.fasta,,
"",,,," Sample 85<\/p>\n",Phaonia angelicae,,,,,,"","",Yes,TTTTTGGTGCTTGATCAGGAATAGTAGGAACTTCACTAAGTATTCTAATTCGAGCCGAATTAGGACACCCTGGAGCTTTAATTGGAGATGATCAAATTTATAATGTAATCGTAACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTGCCCCTAATATTAGGAGCCCCAGACATAGCCTTTCCTCGAATAAATAATATGAGATTTTGACTTTTACCTCCTGCTTTAACATTGCTGCTAACTAGCAGCATAGTAGAAACTGGAGCTGGAACAGGATGAACTGTTTACCCCCCACTATCATCTAATATTGCTCATGGAGGAGCCTCTGTTGATTTAGCTATTTTTTCCCTTCATTTAGCAGGAATCTCCTCTATTCTAGGAGCCGTAAATTTTATTACAACTGTAATTAATATACGATCAATAGGAATTACATTCGATCGCATACCTTTATTTGTATGATCAGTAGTAATTACAGCTTTATTATTACTTTTATCATTACCTGTTTTAGCAGGAGCTATTACAATATTATTGACAGATCGAAATTTAAATACATCTTTTTTTGA,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/RA85-M13F.fasta,,
"",,,," Sample 84<\/p>\n",Culex pipiens,,,,,,"","",Yes,GTGTATTTATTGGAAATGATCAAATTTATAATGTTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATCATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATGTTAGGAGCTCCAGATATGGCCTTTCCTCGAATAAATAATATAAGTTTTTGAATACTACCTCCTTCATTGACACTACTACTTTCAAGTAGTTTAGTAGAAAATGGGGCTGGGACTGGATGAACAGTGTATCCCCCTCTTTCATCTGGAACAGCTCATGCTGGAGCTTCAGTAGACTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGTGCAGTAAATTTTATTACAACAGTAATTAATATACGATCTTCAGGAATTACTCTTGATCGAATACCTTTATTTGTTTGATCAGTAGTAATTACTGCAGTTTTATTACTTCTTTCTTTACCTGTTTTA,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/RA84-M13F.fasta,,
"",,,," Sample 82<\/p>\n",Phaonia angelicae,,,,,,"","",Yes,TTTTTGGTGCTTGATCAGGAATAGTAGGAACTTCACTAAGTATTCTAATTCGAGCCGAATTAGGACACCCTGGAGCTTTAATTGGAGATGATCAAATTTATAATGTAATCGTAACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTGCCCCTAATATTAGGAGCCCCAGACATAGCCTTTCCTCGAATAAATAATATGAGATTTTGACTTTTACCTCCTGCTTTAACATTGCTGCTAACTAGCAGCATAGTAGAAACTGGAGCTGGAACAGGATGAACTGTTTACCCCCCACTATCATCTAATATTGCTCATGGAGGAGCCTCTGTTGATTTAGCTATTTTTTCCCTTCATTTAGCAGGAATCTCCTCTATTCTAGGAGCCGTAAATTTTATTACAACTGTAATTAATATACGATCAATAGGAATTACATTCGATCGCATACCTTTATTTGTATGATCAGTAGTAATTACAGCTTTATTATTACTTTTATCATTACCTGTTTTAGCAGGAGCTATTACAATATTATTGACAGATCGAAATTTAAATACATCTTTTTTTGACCCTGCAGGA,https://wolbachiaprojectdb.org/wp-content/uploads/2020/10/RA82-M13F.fasta,,
| |
![\"\"](\"https:\/\/wolbachiaprojectdb.org\/wp-content\/uploads\/2022\/04\/D6DE3908-54D3-42C7-A3AD-843C2706DB1F-225x300.jpeg\")
<\/p>\n",Armadillidae,Edwards Buffer,Abdomen,Standard electrophoresis system,PBS,GelGreen,"","![\"\"](\"https:\/\/wolbachiaprojectdb.org\/wp-content\/uploads\/2022\/04\/AB6FB229-8C0F-4B75-8531-25D2317DAA9A-225x300.jpeg\")
<\/p>\n",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/04/ADB23D8B-608B-47E4-ACD7-371D3178D8C3-scaled.jpeg,",39.8289369000,-84.8902382000,03/30/2022,"![\"\"](\"https:\/\/wolbachiaprojectdb.org\/wp-content\/uploads\/2022\/02\/PHOTO-2022-02-23-12-54-31-225x300.jpg\")
<\/p>\n",Culicidae,Instagene Matrix,Whole arthropod,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/IMG_4560-scaled.jpg,",1.4254250000,103.7753330000,02/23/2022,"",Drosophila melanogaster,Instagene Matrix,Whole arthropod,,PBS,,"","",Yes,708 bp,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/IMG-7479-1-scaled.jpg,",,,,"",,,,,,,"","",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/IMG-7478-scaled.jpg,",,,02/23/2022,"",,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/Screenshot-2022-02-25-at-8.54.49-AM.png,",,,02/23/2022,"",,Instagene Matrix,Abdomen,MiniPCR,PBS,,"","",Yes,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/20220223_125544-scaled.jpg,",,,,"",,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/IMG-1677-scaled.jpg,",,,,"",,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/IMG-7388-scaled.jpg,",,,,"",,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/Screenshot-2022-02-25-at-8.52.06-AM.png,",103.7755,1.4258,02/23/2022,"",,,,,,,"","",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/Screenshot-2022-02-24-at-11.50.17-PM.png,",1.4257977,103.7755,02/23/2022,"",Diptera,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/Screenshot-2022-02-24-at-11.51.48-PM.png,",1.4257977,103.7755,02/23/2022,"",Diptera,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/Screenshot-2022-02-23-at-2.47.31-PM.png,",1.4259693082,103.7754141693,02/23/2022,"",Diptera,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/Screenshot-2022-02-24-at-11.43.25-PM.png,",1.4257977,103.7755,02/23/2022,"",Hymenoptera,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/IMG-5172-scaled.jpg,",1.4257977000,103.7755000000,02/24/2022,"",Endopterygota,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/IMG-5176-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/IMG-5174-scaled.jpg,",1.4257977000,103.7755000000,02/24/2022,"",Hexapoda,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/IMG_4717-1-scaled.jpg,",1.4302185000,103.7640034000,02/24/2022,"![\"\"](\"https:\/\/wolbachiaprojectdb.org\/wp-content\/uploads\/2022\/02\/IMG_9788.heic\")
<\/a><\/p>\n",Hexapoda,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/IMG_9348-scaled.jpg,",,,,"",,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/IMG_9356-scaled.jpg,",,,,"",,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/IMG_9362-scaled.jpg,",,,,"",,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/fly-1.jpg,",1.4257654,103.7754619,02/23/2022,"",Diptera,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/Snapchat-1483566675-1-scaled.jpg,",1.4258,103.7355,02/23/2022,"",,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/ant-2.jpg,",1.4257654,103.7754619,02/23/2022,"",Hymenoptera,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/Snapchat-755128865-scaled.jpg,",1.4258,103.7355,02/23/2022,"",,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/ant-1.jpg,",1.4257654000,103.7754619000,02/23/2022,"",Hymenoptera,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/Snapchat-498551139-scaled.jpg,",1.4258,103.7355,02/23/2022,"",,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/IMG_9354-scaled.jpeg,",1.4257977000,103.7755000000,02/23/2022,"",,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/Snapchat-776549737-scaled.jpg,",1.4258000000,103.7355000000,02/23/2022,"",Rhaphidophoridae,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/32F7BC32-798E-4EF9-BC3F-929C90ED325B.png,",1.4257977,103.7755,02/23/2022,"",Hexapoda,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/IMG_7350-scaled.jpg,",1.4258180000,103.7739299000,02/23/2022,"",Insecta,Instagene Matrix,Abdomen,MiniPCR,PBS,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2022/03/Screenshot-2022-03-11-at-9.11.06-AM.png,","",Unknown,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/IMG_7100.jpg,",1.4257977000,103.7755000000,02/23/2022,"",Hymenoptera,Instagene Matrix,Whole arthropod,Standard electrophoresis system,PBS,,"","",No,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2022/02/IMG_0134-scaled.jpg,",1.4257977000,103.7755000000,02/23/2022,"![\"\"](\"https:\/\/wolbachiaprojectdb.org\/wp-content\/uploads\/2022\/01\/Screenshot-2022-01-28-12.41.22-PM-223x300.png\")
<\/p>\n![\"\"](\"https:\/\/wolbachiaprojectdb.org\/wp-content\/uploads\/2021\/08\/IMG-1714-300x225.jpg\")
<\/p>\n![\"\"](\"https:\/\/wolbachiaprojectdb.org\/wp-content\/uploads\/2021\/07\/EEBD2588-3DA4-4B3F-9A9C-C9601220E49E-225x300.jpeg\")
<\/p>\n",Insecta,,,,,,"","",,,,,
"https://wolbachiaprojectdb.org/wp-content/uploads/2021/07/image1-39-rotated.jpeg,",40.5682900000,-74.4173877000,06/11/2020,"