# This file is a CSV export of the The Wolbachia Project database on Mar 14 2026 23:57:10 GMT image_urls,location_lat,location_lon,collection_date,observations,putative_identification,dna_extraction_kit,dna_extraction_location,gel_rig,running_buffer,dna_stain,gel_image_urls,protocol_notes,wolbachia_presence,wolbachia_16s_sequence,wolbachia_16s_fasta,wolbachia_16s_ab1,arthropod_COI_sequence,arthropod_COI_fasta,arthropod_COI_ab1, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/03/Screenshot-2026-03-12-at-11.03.31-AM.png,",40.8148000000,77.8653000000,09/20/2025,"

The Japanese Burrowing Cricket was caught near a tree in its natural habitat.<\/p>\n",Arthropoda,DNeasy (Qiagen),Abdomen,,1X TAE,Ethidium Bromide,"","

DNA Extraction:<\/strong> The arthropod was crushed well, and the abdomen was efficiently dissected.<\/span>\u00a0No exoskeleton was noticed to be included.<\/p>\n

Analysis: <\/strong>My controls and sample worked as expected.<\/p>\n",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/03/Screenshot-2026-03-04-at-10.30.40-PM.png,",12532.5,1034632.5,03/03/2026,"

Looks like an ant. Bigger than other bugs that were caught. Some limbs seem to be missing. Viewed under a microscope.<\/p>\n",Arthropoda,,,,,,"","",,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/03/Screenshot-2026-03-04-at-10.30.26-PM.png,",12532.5000000000,1034632.5000000000,03/03/2026,"

Limbs\/Antennae seem to be stretched out. Looks like an ant.<\/p>\n",Arthropoda,,,,,,"","",,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/03/IMG_5201-scaled.jpeg,",,,03/03/2026,"",Arthropoda,,,,,,"","",,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/03/IMG_5209-scaled.jpeg,",,,03/03/2026,"",Arthropoda,,,,,,"","",,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/03/IMG_0059-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/03/IMG_0727-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/03/IMG_0726-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/03/IMG_0067-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/03/IMG_0066-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/03/IMG_0065-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/03/IMG_0064-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/03/IMG_0063-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/03/IMG_0062-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/03/IMG_0060-scaled.jpg,",,,,"",,,,,,,"","",,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/bug.jpeg,",42.460507,73.316389,02/24/2026,"

Found on webs underneath reptile tank. Observed at least 4 other spiders of similar appearance nearby. 8 long legs, Small head, connected thorax and long patterned abdomen. Beige in appearance. Black and white patterns around jointed legs.<\/p>\n",Pholcus phalangioides,,,,,,"","",,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/Screenshot-2026-02-24-at-11.35.14-AM.png,",42.2303599000,-73.3216874000,02/15/2026,"

Captured inside of home after specimen had entered through opening in window during winter. Likely seeking warmth and food source. Killed the specimen before collection.<\/p>\n",Musca domestica,Monarch DNA extraction (NEB),Abdomen,,,,"","

We used a DNA extraction protocol based on the insect adaptation of New England Biolabs\u2019 Monarch Spin gDNA Extraction kit (Product # T3010). The specimen was incubated for 53 minutes in a hot water bath at 56 degrees C. The written protocol was followed closely.<\/p>\n

Our first PCR reaction was set up on 10 March 2026, and was a duplex reaction because we used both the Arthropod CO1 and Wolbachia 16S primers together. We used an annealing temperature of 49 degrees celcius and Taq polymerase – New England Biolabs OneTaq Hot Start Quick-Load 2X Master Mix with Standard Buffer (#M0488S).<\/p>\n",,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_7055-scaled.jpeg,",44.9262700000,93.1726600000,09/08/2025,"

I collected my wasp in the afternoon. It was in the low 70s F. It was near my wooden deck, in my backyard, when I collected it. The picture I attached was from a petri dish.<\/p>\n",Polistes dominula,DNeasy (Qiagen) blood and tissue kit,Abdomen,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-27-142718.png,","

Followed Wolbachia Project Protocols<\/p>\n",Yes,,,, "",40.8132000000,77.8773000000,10/03/2025,"

This was the only ant that was on a rick and in some mulch, so I collected it. It was a clear day with little wind.<\/p>\n",Prenolepis imparis,QIAGEN DNeasy kit,Abdomen,agarose gel electrophoresis,TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_7096-1-scaled.jpeg,","

There was no problem with the protocol, so I am confident that my arthropod was not infected with\u00a0Wolbachia<\/em>.<\/p>\n",No,,,, "",,,,"",Vespula germanica,pcr,Abdomen,,,,"","",No,CTTTTNTGAGCAGGAACTTTAGGAGCTTCAATAAGAATAATTATTCGTTTAGAATTAAGATCCCCTGGAGCTTTAATTAATAATGATCAAATTTATAATACTATTATTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTTATACCTTTTTTAGTTGGAGGATTTGGAAATTGATTAATCCCTTTAATATTAGGTGTTCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCATCCTTATTTTTATTAATCTTAAGAAATTTTATTGGAACCGGAGTAGGGACAGGATGAACTCTGTACCCTCCTTTATCATCAATTGTAGGACATGACTCTCCCTCTGTAGACTTAGGAATTTTTTCTATCCATATTGCTGGAATTTCATCAATTATAGGTTCAATTAATTTTATTGTTACTATTTTAAATATACACACAAAAACACATTCACTAAATTTTCTTCCTTTATTTTCATGATCAATTTTAATTACAGCAATTCTTCTCTTGTTATCTCTACCAGTTCTTGCAGGAGCAATTACTATACTTCTTACAGACCGTAATTTAAATACATCTTTCTTTGATCCTGCAGGCGGAGGTGACCCAATTTTATACCAACATTTATTTTGATTTTTTGGTCAC,https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/7E-CO1F-1.fasta,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Leaf-Bug-1-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Backpack-cropped-scaled.jpg,",44.9860700000,-93.1958600000,09/06/2025,"

I found this leaf bug in my yard. It landed on my sister’s backpack, and I collected it there. It was around noon that I collected it. It was sunny outside.<\/p>\n",Acanalonia,DNeasy (Qiagen) blood and tissue kit.,Whole arthropod,agarose gel electrophoresis,TBE,SeaGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-22-175133.png,","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_0732-scaled.jpg,",,,09/10/2025,"

Captured in wood chips, a slender, black, circular body appears to have plating or a protective shell. The bug also has many legs.<\/p>\n",Cylindroiulus caeruleocinctus,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-27-122139.png,","

Followed Wolbachia Project Protocols<\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_0417-1.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_0416.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_0415.jpg,",44.9340700000,-93.1329200000,09/06/2025,"

\"\"<\/p>\n

I found the specimen crossing the sidewalk. I collected it mid-day, around 12 pm. It was around 60 degrees, slightly windy, and cloudy. I attached a picture of the area where I collected the specimen. There were not many other bugs out when I collected it.<\/p>\n",Harpalus herbivagus,DNeasy (Qiagen),Abdomen,agarose gel electrophoresis,TBE,SeaGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-27-124301.png,","

Followed Wolbachia Project Protocols<\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/Wolbachia-Arthropod-Picture-_page-0001.jpg,",40.8120000000,77.8600000000,10/04/2025,"

I found this spotted lanternfly in a tailgate lot off of Penn State’s Main Campus. I collected it in the late morning, around 11, and it was overcast and about 72 degrees F outside. I couldn’t get a picture of it because it was trying to fly away. There were many spotted lanternflies, but I only collected one.<\/p>\n",Reticulitermes flavipes,QIAGEN DNeasy kit,Abdomen,MiniPCR,TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/Wolbachia-Arthropod-Picture-2_page-0001.jpg,","

No unexpected issues occurred during the DNA extraction, PCR setup, or gel electrophoresis. All steps were performed according to the lab protocol, and no errors occurred during the experiment. Pipette tips were changed between samples to avoid contamination, and work surfaces were cleaned before and after use. PCR reactions were prepared in separate areas to reduce the risk of cross-contamination. All controls behaved as expected, indicating that the procedures were carried out correctly and that the results are reliable.<\/p>\n

Lane 1: DNA Ladder<\/p>\n

Lane 2: Host COI PCR product from the termite specimen<\/p>\n

Lane 3: Wolbachia wsp PCR product from the termite specimen<\/p>\n

Lane 4: Wolbachia-positive control<\/p>\n

Lane 5: Wolbachia-negative control<\/p>\n

Lane 6: Water<\/p>\n

Host COI PCR was used to verify DNA quality and confirm successful extraction, while Wolbachia-specific wsp PCR was used to screen for Wolbachia infection. The presence of a clear COI band and correct control outcomes indicate that the PCR conditions were effective. The absence of a wsp band in the specimen suggests that Wolbachia was not detected under these assay conditions.<\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_8189-scaled.jpeg,",44.9262000000,93.1743000000,,"

Large, Ant, missing a leg. Specific Species unknown. Caught in grass under cottonwood trees on a cool day, 50-60 degrees Fahrenheit, ant colony near.<\/p>\n",Camponotus pennsylvanicus,DNeasy (Qiagen) blood and tissue kit,Abdomen,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-26-194425-1.png,","

Followed Wolbachia Project Protocols<\/p>\n",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-06-143710.png,",44.9262000000,93.1743000000,09/09/2025,"

I collected this fly in the late afternoon at 4 pm inside the school building. I found it dead on a table; it was a little stuffy, so I would assume it was 70-ish degrees Fahrenheit.<\/p>\n",Condylostylus,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-22-131949.png,","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/9F2F8E69-8598-435F-85B3-DED741D58B5D-scaled.jpeg,",40.78576,77.87784,10/02/2025,"

I found the millipede under some moss near a tree stump at the Penn State golf courses. It was in a moist environment under the moss. The weather was a nice sunny day, however, the millipede was under shade in darkness.<\/p>\n",Polydesmidae,DNeasy (Qiagen),Whole arthropod,agarose gel electrophoresis,1X TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/Image-2-9-26-at-10.24-PM.jpeg,","

DNA extraction: The entire arthropod was crushed in the tube, including the exoskeleton because it was very small.<\/p>\n

Gel Electrophoresis Lanes<\/p>\n\n\n\n\n\n\n\n\n\n\n
Lane<\/strong><\/td>\nSubstance<\/strong><\/td>\n<\/tr>\n
1<\/td>\nDNA Ladder<\/td>\n<\/tr>\n
2<\/td>\nPartner arthropod<\/td>\n<\/tr>\n
3<\/td>\nMy arthropod (millipede)<\/strong><\/td>\n<\/tr>\n
4<\/td>\nPositive Control<\/td>\n<\/tr>\n
5<\/td>\nNegative control<\/td>\n<\/tr>\n
6<\/td>\n(+) DNA<\/td>\n<\/tr>\n
7<\/td>\n(-) water<\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

\n

 <\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/IMG_9222-scaled.jpeg,",,,10/20/2022,"

Small Arthropod<\/p>\n

Black, almost shriveled<\/p>\n

Was given to the group for a second test<\/p>\n",Isoptera,Qiagen kit for blood and tissues.,Whole arthropod,MiniPCR,1X TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/IMG_9522.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/IMG_9523.jpeg,","

Figure 1: Gel electrophoresis showing Arthropod DNA results, after 35 minutes of electrophoresis. The 1% agarose gel was stained with 0.5X GelGreen nucleic acid dye with 1X TBE buffer to visualize the DNA bands. Lane 1 contains a 100 bp DNA ladder, lane 2 contains LG arthropod sample (old), lane 3 contains KC arthropod sample (old), lane 4 contains a positive arthropod control (old), lane 5 contains a negative arthropod control (old), lane 6 contains RB arthropod sample (old), lane 7 contains water, lane 8 contains a positive DNA control, lane 9 contains Termite DNA sample (new), lane 10 contains a positive arthropod control (new), and lane 11 contains a negative arthropod control (new)<\/p>\n

Figure 2: Gel electrophoresis showing Wolbachia DNA results, after 30 minutes after electrophoresis. The 1% agarose gel was stained with 0.5X GelGreen nucleic acid dye with 1X TBE buffer to visualize the DNA bands. Lane 1 contains a 100 bp DNA ladder, lane 2 contains LG wolbachia sample (old), lane 3 contains KC wolbachia sample (old), lane 4 contains a positive wolbachia control (old), lane 5 contains a negative wolbachia control (old), lane 6 contains RB wolbachia sample (old), lane 7 contains water, lane 8 contains a positive DNA control, lane 9 contains Termite DNA sample (new), lane 10 contains a positive wolbachia control (new), and lane 11 contains a negative wolbachia control (new)<\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/IMG_1190-scaled.jpeg,",,,09/17/2026,"",Arthropoda,Blood and Tissue kit,Whole arthropod,,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/IMG_1197.jpeg,","",,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_7925.jpeg,",42.4842200000,71.1420300000,09/17/2025,"

The arthropod was found by a tunnel web going into a nearby fence<\/p>\n

Very small Potters Grass Spider (Agelenopsis potteri )
\nHad light brown legs (lightest area of the spider)
\nHad a black\/brown body with a light brown stripe down the center<\/p>\n

Arachnida<\/p>\n",Arachnida,Qiagen kit for blood and tissues.,Whole arthropod,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/IMG_9522.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/IMG_9523-1.jpeg,","

Figure 1: Gel electrophoresis showing Arthropod DNA results, after 35 minutes of electrophoresis. The 1% agarose gel was stained with 0.5X GelGreen nucleic acid dye with 1X TBE buffer to visualize the DNA bands. Lane 1 contains a 100 bp DNA ladder, lane 2 contains LG arthropod sample (old), lane 3 contains KC arthropod sample (old), lane 4 contains a positive arthropod control (old), lane 5 contains a negative arthropod control (old), lane 6 contains RB arthropod sample (old), lane 7 contains water, lane 8 contains a positive DNA control, lane 9 contains Termite DNA sample (new), lane 10 contains a positive arthropod control (new), and lane 11 contains a negative arthropod control (new).<\/p>\n

Figure 2: Gel electrophoresis showing Wolbachia DNA results, after 30 minutes after electrophoresis. The 1% agarose gel was stained with 0.5X GelGreen nucleic acid dye with 1X TBE buffer to visualize the DNA bands. Lane 1 contains a 100 bp DNA ladder, lane 2 contains LG wolbachia sample (old), lane 3 contains KC wolbachia sample (old), lane 4 contains a positive wolbachia control (old), lane 5 contains a negative wolbachia control (old), lane 6 contains RB wolbachia sample (old), lane 7 contains water, lane 8 contains a positive DNA control, lane 9 contains Termite DNA sample (new), lane 10 contains a positive wolbachia control (new), and lane 11 contains a negative wolbachia control (new)<\/p>\n",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/IMG_7328-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/IMG_7537-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/IMG_7536-scaled.jpeg,",40.5009300000,-75.9699300000,11/12/2025,"

Small, oval-shaped, red abdomen with black spots, black head with white spots, no more than 2cm wide and long<\/p>\n",Coccinellidae,DNeasy (Qiagen),Whole arthropod,Standard electrophoresis system,1X TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/Wolbachia-Gel-Image-150x150-1.png,","",Unknown,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/Screenshot-2026-02-04-at-4.39.54-PM.png,",,,09/17/2025,"

Orthoptera<\/p>\n",Orthoptera,Qiagen kit for blood and tissues.,Abdomen,MiniPCR's BlueGel,1X TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/Screenshot-2026-02-03-at-1.41.18-PM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/Screenshot-2026-02-09-at-8.05.16-AM-1.png,","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/1FD44236-24BE-478C-A0FA-BE70A7255509.png,",,,09/17/2025,"

Founded at a bottom of the tree<\/p>\n

Carries Wolbachia<\/p>\n",Arthropoda,DNeasy (Qiagen) blood and tissue kit.,Whole arthropod,agarose gel electrophoresis,TBE,GelGreen,"","",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/IMG_1038-scaled.jpeg,",,,09/17/2025,"",,DNeasy (Qiagen) blood + tissue kit with modification P2 for ATL + N3 for AL,Whole arthropod,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/image-1.jpeg,","",,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/tempImagetUmWZ3-scaled.jpg,",,,09/29/2025,"

The arthropod was found by itself along a path through Hort Woods. It was found at 6:11 pm on September 29, 2025. The weather was about 72 degrees and cloudy.<\/p>\n",Camponotus pennsylvanicus,QIAGEN DNeasy kit,Abdomen,agarose gel electrophoresis,1X TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_6520.jpg,","

The gel shows many filled lanes due to an error during well filling. Each sample was pipetted into two wells instead of one.<\/p>\n

Gel electrophoresis lanes:<\/p>\n

1- ladder<\/p>\n

2,3- lanes 2 and 3 were the arthropod sample<\/p>\n

 <\/p>\n

 <\/p>\n",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/ant.jpg,",404729.0000000000,775131.0000000001,10/20/2026,"

Ants were collected from different locations around the Penn state campus located in state college Pennsylvania. Collection of ants was random to ensure validity of study. A total sample size of (n=3) ants were collected. It was a sunny day, and the ants were behaving normally. The temperature was approximately 50 degrees with slight winds.<\/p>\n",Arthropoda,DNeasy (Qiagen),Whole arthropod,agarose gel electrophoresis,TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/IMG_7093-scaled.jpg,","

Arthropods were collected from Penn state campus by using sterile tweezers and 95% ethanol to preserve the specimens and prevent DNA degradation. Each sample was then labeled according to the collection location and stored in a -20-degree Celsius fridge until processing. DNA was then extracted from the samples by a lysis buffer and then ethanol precipitation to isolate genetic material. Polymerase Chain Reaction (PCR) was then performed by using primers that were specific to the Wolbachia protein gene (WSP). Positive and negative controls were included to validate amplification. \u00a0Each sample contained DNA, primers, and controls for Wolbachia. Gel electrophoresis was then preformed on an agarose gel stained with die and then visualized under UV light. The presence of a clear band indicated Wolbachia was present.\u00a0Lanes 1, 8,10,14, &15 display positive results for Wolbachia.<\/p>\n

Lane, one contained the PCR ladder control<\/p>\n

Lane two contained the negative PCR control<\/p>\n

Lane three contained the negative DNA extraction control<\/p>\n

Lane eight contained the positive DNA extraction control<\/p>\n

Lane fourteen and fifteen contained my samples<\/p>\n

All other lanes were left empty for better readability<\/p>\n

 <\/p>\n

 <\/p>\n",Yes,,,, "",40.7970000000,77.8610000000,09/28/2025,"

An arthropod was observed in front of the HUB at approximately 6:30 PM. The weather conditions were cloudy, with an estimated temperature of around 75\u00b0F. The organism was found on the ground surface and was observed crawling slowly across the pavement. No interactions with other organisms were noted during the observation period.<\/p>\n

The arthropod was discovered incidentally while walking through the area and was identified through general knowledge based on its small size, dark coloration, and typical movement pattern. The surrounding environment consisted of paved walkways and nearby grassy areas, which are consistent with the habitat of this organism.<\/p>\n",Formicidae,DNeasy (Qiagen),Whole arthropod,agarose gel electrophoresis,1X TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/gel.jpg,","

Care was taken to avoid cross-contamination by using clean pipette tips and changing tips between samples. Wells were loaded carefully to prevent sample overflow or mixing between lanes. Positive and negative controls were included on each gel to validate PCR and electrophoresis results. The gel was run long enough to allow clear separation of bands, and exposure to UV light was minimized to prevent DNA damage.<\/p>\n",No,,,, "",44.9500000000,93.0900000000,09/10/2025,"

Yellow-orange body with black dots on its top, bottom side is same color with multiplee legs tucked in<\/p>\n",Insecta,,,,,,"","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/04_MF_251.jpeg,",40.3180866000,-76.0144653000,08/31/2031,"

Red with black spots, Wings under a hard shell, ~2-3mm diameter (circular\/oval-shaped shell)<\/p>\n",Harmonia axyridis,DNeasy (Qiagen),Partial abdomen,Standard electrophoresis system,TBG,SYBR-SAFE,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/gel-Mock-1.png,","

Standard.<\/p>\n",No,TTATGGGCAGGAATAGTAGGAACATCGTTAAGTATTTTAATTCGGTTAGAATTAGGAACTAGAGGAA GATTAATTGGAAACGACCAAATTTATAATATAATTGTTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTAATACCT ATTATAATTGGGGGTTTTGGAAATTGATTAGTTCCTTTAATAATTGGAGCTCCTGATATAGCATTTCCACGATTAAATAA CATAAGATTTTGACTTTTACCCCCTGCTTTAACTCTTTTAATTTTAAGAACAATCGTAGAAATAGGGGCAGGAACAGGAT GAACTGTTTACCCTCCTCTTTCTTCTAATTTAACACATAATGGGCCTTCAGTAGATTTAGTGATTTTTAGTTTACATTTA GCAGGAATTTCCTCAATTTTAGGTGCAGTAAATTTCATTTCAACTATTATAAATATACGTCCATTTGGTATAATACTTGA TAAAACTCCTTTATTTGTATGATCTGTTCTTATTACAGCAATTCTTTTATTACTATCACTACCAGTTCTTGCAGGAGCAA TTACTATACTATTAACTGACCGAAACTTAAATTCTTCTTTTTTTGACCCAACCGGTGGGGGAGACCCAATTTTATACCAA CATTTATTTTGATTTTTTGC,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/01.MH_.25-scaled.jpg,",40.5496710000,-76.0033380000,11/09/2025,"

brown body, two segments, 2 cm in length, 8 legs<\/span><\/p>\n",Lycosidae,DNeasy (Qiagen),Partial abdomen,agarose gel electrophoresis,TBG,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Hoover-Wolbachia-Project-Electrophoresis.jpg,","

Standard<\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/01_AU_252-2-scaled.jpeg,",40.4976900000,76.1368100000,11/04/2025,"

Color from yellow-orange to red, may have 0\u201319 black spots on the wing covers, black \u201cM\u201d or \u201cW\u201d on white area behind head, size about 7\u20138 mm long, oval, dome-shaped body, short legs, antennae<\/p>\n",Harmonia axyridis,DNeasy (Qiagen),Partial abdomen,Standard electrophoresis system,TBG,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Gel_Image_MA-1.png,","

Standard<\/p>\n",No,>Asian Lady Beetle TATAATATAATTGTTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTAATACCTATTATAATTGNGGGTTTTGGAAA TTGATTAGTTCCTTTAATAATTGGAGCTCCTGATATAGCATTTCCACGATTAAATAACATAAGATTTTGACTTTTACCCC CTGCTTTAACTCTTTTAATTTTAAGAACAATCGTAGAAATAGGGGCAGGAACAGGATGAACTGTTTACCCTCCTCTTTCT TCTAATTTAACACATAATGGGCCTTCAGTAGATTTAGTGATTTTTAGTTTACATTTAGCAGGAATTTCCTCAATTTTAGG TGCAGTAAATTTCATTTCAACTATTATAAATATACGTCCATTTGGTATAATACTTGATAAAACTCCTTTATTTGTATGAT CTGTTCTTATTACAGCAATTCTTTTATTACTATCACTACCAGTTCTTGCAGGAGCAATTACTATACTATTAACTGACCGA AACTTAAATTCTTCTTNTTTTGACCCNACCGGTGGGGGAGNNCCAATTTNATACNNACATTTANTTTGNNTTTTNNNNNN NNNNNNNNNNNNN,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/AsianLadyBeetle.fasta,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Furrowed-ant.jpg,",40.5517264580,75.9748349880,11/04/2025,"

About 5mm long, black head and midsection with a light brown towards the end. Black legs. It was winged and had antennas.<\/p>\n",Myrmica,DNeasy (Qiagen),Abdomen,Standard electrophoresis system,TBG,SYBR-SAFE,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Gel-walbachia.jpg,","",Unknown,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_5886-1.png,",40.5441121000,-76.0103733000,11/09/2025,"

a small dome shaped beetle, thats typically red or orange with black spots<\/p>\n",Coccinellidae,DNeasy (Qiagen),Partial abdomen,Standard electrophoresis system,TBG,SYBR-SAFE,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-29-203206.png,","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-29-at-7.31.11-PM.png,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-29-at-7.32.27-PM.png,",402901.9000000001,761109.1000000001,11/05/2026,"

a small (about 5-6 mm), round beetle that can be red, orange, or yellow with black spots and six legs<\/p>\n",Harmonia axyridis,Qiagen DNEASY,Partial abdomen,Standard electrophoresis system,TBG,SYBR-SAFE,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-29-at-7.37.32-PM.png,","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/01.MA_.2025-1.jpeg,",40.552811,75.955855,,"

Orangeish red with black spots, Wings under a hard shell, 8mm diameter, circular-shaped shell<\/p>\n",Arthropoda,DNeasy (Qiagen),Abdomen,Standard electrophoresis system,TBG,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Gel_Image_MA.png,","

STANDARD<\/p>\n",Unknown,Asian Lady Beetle TATAATATAATTGTTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTAATACCTATTATAATTGNGGGTTTTGGAAA TTGATTAGTTCCTTTAATAATTGGAGCTCCTGATATAGCATTTCCACGATTAAATAACATAAGATTTTGACTTTTACCCC CTGCTTTAACTCTTTTAATTTTAAGAACAATCGTAGAAATAGGGGCAGGAACAGGATGAACTGTTTACCCTCCTCTTTCT TCTAATTTAACACATAATGGGCCTTCAGTAGATTTAGTGATTTTTAGTTTACATTTAGCAGGAATTTCCTCAATTTTAGG TGCAGTAAATTTCATTTCAACTATTATAAATATACGTCCATTTGGTATAATACTTGATAAAACTCCTTTATTTGTATGAT CTGTTCTTATTACAGCAATTCTTTTATTACTATCACTACCAGTTCTTGCAGGAGCAATTACTATACTATTAACTGACCGA AACTTAAATTCTTCTTNTTTTGACCCNACCGGTGGGGGAGNNCCAATTTNATACNNACATTTANTTTGNNTTTTNNNNNN NNNNNNNNNNNNN,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_0561.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_0562.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_0563.jpeg,",404825.0000000000,775140.0000000001,10/02/2025,"

The specimen was observed and collected from underneath a tree during midday, around 2 pm. The weather was warm, about 60\u00b0F. The Asian lady beetle was active at the time of observation, moving across the dirt. It was then transferred to the sidewalk for easier collection. It had typical orange coloration with black markings.<\/p>\n",Harmonia axyridis,QIAGEN DNeasy kit,Whole arthropod,agarose gel electrophoresis,TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_0565.jpeg,","

Due to the small size of the specimen, the whole organism was thoroughly homogenized with a micro-pestle prior to DNA extraction to maximize recovery of reproductive tissue DNA. Wolbachia-positive and negative controls were run alongside the sample during PCR and gel electrophoresis to verify assay reliability. Gel migration was monitored closely, and results were documented immediately after UV visualization.<\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/22808E03-3C25-4F59-9CD5-FA3FF5693030_1_105_c.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/ABBA6166-9DD3-42D0-AAE4-3FEA54DE610F_1_105_c.jpeg,",,,09/17/2025,"",Armadillidium vulgare,Qiagen kit for blood and tissues.,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/Isla-Brown-Wolbachia-Lab-Results-template-1.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/Isla-Brown-Wolbachia-Lab-Results-template-2.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/Isla-Brown-Wolbachia-Lab-Results-template-3.jpg,","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/01.EH_.251-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/01.EH_.252-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/01.EH_.253.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-29-152548.png,",75.9746000000,40.5516700000,11/04/2025,"

Light tan with a greenish hue and light brown near the head. Very skinny and short in shape, and seemed to be about a millimeter wide. <\/span><\/p>\n",Geometridae,QIAGEN DNeasy kit,Whole arthropod,Standard electrophoresis system,1X TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Wolbachia-Gel-Image-.png,","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-29-132650.png,",403425,755537,11/09/2025,"

small, round beetle with a bright, colorful shell. Smooth, shiny, dome-shaped body with red or orange with black spots on outer wing.<\/p>\n",Arthropoda,QIAGEN DNeasy kit,Abdomen,Standard electrophoresis system,1X TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-29-133601.png,","",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/05.KR_.2025-1-scaled.jpeg,",40.5805630000,-76.0242780000,11/05/2025,"

dome shaped beetle black spots hard shell covering wings white spots near eyes orange color<\/span><\/p>\n",Coccinellidae,DNeasy (Qiagen),Abdomen,Standard electrophoresis system,1X TAE,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-29-131615.png,","

We extracted the samples DNA by crushing it in a test tube and centrifuging the sample. We then put the samples DNA into a gel electrophoresis chamber and sent the DNA to be analyzed.<\/p>\n",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/01.BS_.25-1-scaled.jpg,",403004.5000000000,755810.7000000001,11/05/2025,"

Slender, dirt-colored insect about less than half an inch long with a dark, elongated head and a distinct\/long neck.<\/p>\n",Myodocha serripes,DNeasy (Qiagen),Partial abdomen,agarose gel electrophoresis,TBG,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-29-115045.jpg,","

Standard<\/p>\n",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_0953.jpeg,",40.7790,77.8643,09/24/2025,"

The collected arthropod was found on the ground outside Mueller Laboratory on the Penn State University Park campus in State College, Pennsylvania. Collection occurred in the late fall season, under cool dry weather conditions. The specimen was found on a terrestrial surface near concrete walkways surrounding leaves and vegetation. The arthropod appeared ant-like and was actively moving along the surface. \"\"<\/p>\n",Formicidae,DNeasy (Qiagen),Abdomen,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_0955.jpeg,","

The PCR and gel electrophoresis for the arthropod showed that lane 2 (Ant Sample) did not have a visible band for the CO1 gene. Since there was no band for CO1 it suggests that the region did not amplify correctly or that the DNA from the arthropod was too low to be detected. The positive control for CO1 produced a clear band, and the negative control showed no amplification which means that the PCR was free of contamination. The lack of no visible CO1 band is in correlation with the ant sample and not the entire PCR process. On the other hand, the 16S rRNA PCR for Wolbachia showed a faint band in lane 2. This band was weaker than the band in the Wolbachia positive control, it was present for the 16S rRNA target. The negative control lane did not show amplification, which means that the band is not due to contamination. The presence of this band shows possible Wolbachia infection, but the faint band shows that it was present in low concentration.<\/p>\n",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-29-100807.png,",40.56806,-75.98313,11/09/2025,"

2.5 – 4.5 mm long, black abdomen and head, dark brown midsection, brown legs and antenna<\/p>\n",Prenolepis imparis,DNeasy (Qiagen),Whole arthropod,agarose gel electrophoresis,TBG,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-29-101702.png,","

Standard<\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_6476-scaled.jpg,",404819.0000000000,775209.0000000001,09/30/2025,"",Bombus,QIAGEN DNeasy kit,Abdomen,,TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Labeled-Gel.png,","",Unknown,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/1000001178-scaled.jpg,",44.9874550000,-93.1909220000,09/07/2025,"",Hymenoptera,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,agarose gel electrophoresis,TBE,,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-28-205118.png,","

Sample is 7D in lane 5 of the gel.<\/p>\n",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/20250930_145100-scaled.jpg,",40.0000000000,77.0000000000,,"

This arthropod was collected from the sidewalk at Penn State University on a fall evening at 5:30 PM. It was about 75 degrees F outside.<\/p>\n",Harmonia axyridis,Qiagen DNeasy Blood and Tissue Kit,Abdomen,Standard electrophoresis system,1X TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/20251014_153007-scaled-e1769635079115.jpg,","

DNA extraction:\u00a0<\/strong>the arthropod was crushed, and only the abdomen was removed and dissected.<\/p>\n

Gel electrophoresis lanes\u00a0<\/strong>for CO1 arthropod PCR:<\/p>\n

1- DNA Ladder<\/p>\n

3- My sample<\/p>\n

5- My lab partner’s sample<\/p>\n

7- Known arthropod positive for Wolbachia DNA (PCR control)<\/p>\n

9- Known arthropod negative for Wolbachia DNA (PCR control)<\/p>\n

11- DNA positive control<\/p>\n

13- DNA negative control<\/p>\n

Analysis:\u00a0<\/strong>All controls and samples worked properly, showing reliable results.<\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-27-190257.png,",40.5660700000,75.9885300000,11/09/2025,"

Very small, oval shaped, gray color, has lines on each little part of it, has 8 legs, curls up into a ball when picked up.<\/p>\n",Armadillidium vulgare,tweezers,Whole arthropod,MiniPCR,TBG,SYBR Safe,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/20251124_111953-scaled.jpg,","",Unknown,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_8998-scaled.jpeg,",44.9264286000,-93.1733385000,10/19/2025,"

Caught in 64\u00b0F, Cool Weather.<\/p>\n",Arthropoda,Qiagen DNeasy Blood and Tissue Kit.,Abdomen,MiniPCR,TBE,SeeGreen,"","

Followed Wolbachia Project Protocols<\/p>\n",No,,,, "",44.9000000000,93.1000000000,09/05/2025,"

Black six legged beetle<\/p>\n",Poecilus chalcites,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,Standard electrophoresis system,Other,Other,"","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Cricket-scaled.jpeg,",44.9191320000,-93.1965810000,09/08/2026,"

This cricket was bought live from Petco, so it is nutritionally enhanced, as it was originally meant to be fed to someone’s lizard. It was about 60-70(\u00b0F) where the crickets were stored.<\/p>\n",Acheta domesticus,DNeasy (Qiagen) blood and tissue kit,Abdomen,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-27-142818.png,","",Unknown,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_3114-1.png,",44.9300000000,93.1700000000,09/08/2025,"

Black and Large<\/p>\n",Formicidae,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-26-155910-1.png,","

Followed Wolbachia Project protocols.<\/p>\n",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_3357-scaled.jpeg,",,,09/02/2025,"

\"\"<\/p>\n

I collected this specimen on a sunny day after school on September 2nd, around 4 pm, and it was around 60 degrees. Arthropod has 6 legs, Black, Long antennas, and 2 wings.<\/p>\n",Ocypus olens,DNeasy (Qiagen) blood and tissue kit,Abdomen,MiniPCR,TBE,SeeGreen,"","

followed Wolbachia project protocols<\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-08-085318.png,",44.9265506470,-93.1734200000,09/08/2025,"

Tiny and very small with 6 legs and<\/p>\n",Tetramorium,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,SeaGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-22-135206.png,","

Followed Wolbachia Project Protocols<\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_5363-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_6202-scaled.jpg,",44.9537000000,93.0900000000,09/05/2025,"

This bug was found in some dirt and rocks. Specifically, it was located under a brick. Many types of bugs were found under there but I picked the biggest. On this day it was overcast and windy.<\/p>\n",Arthropoda,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-22-132235.png,","

Followed wolbachia protocol<\/p>\n",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/AF3F1BB9-715F-477B-93E2-01E9A9530783_1_105_c.jpeg,",,,09/17/2025,"",Tipula oleracea,Qiagen kit for blood and tissues.,Abdomen,MiniOne,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/Isla-Brown-Wolbachia-Lab-Results-template-1.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/Isla-Brown-Wolbachia-Lab-Results-template-2.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/02/Isla-Brown-Wolbachia-Lab-Results-template-3.jpg,","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_6266-scaled.jpg,",44.8900000000,-92.7835000000,09/08/2025,"

large greenish brown grasshopper.<\/p>\n",Orthoptera,DNeasy (Qiagen) blood + tissue kit with modification P2 for ATL + N3 for AL,Abdomen,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-27-142458.png,","

followed Wolbachia project protocols<\/p>\n",No,GGTGCATGAGCTGGATAGTAGGAACTTCTATAAGAATAATTATTCGAGCAGAACTAGGTCAACCAGGATCTTTAATTGGAGATGACCAAATCTATAATGTTATTATTACAGCCCACGCATTTGTAATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTACCATTAATAATTGGAGCACCAGATATAGCATTTCCACGAATAAATAATATAAGTTTTTGACTTTTACCACCATCACTAACTCTTTTACTTACCTCATCCATGGTTGATAATGGAGCTGGTACAGGATGAACAGTTTACCCTCCGCTCGCCGGAGCAATTGCACATGGAGGAGCCTCAGTTGATTTAGCCATTTTCTCTCTTCACTTAGCTGGTATTTCATCAATTCTAGGAGCAGTTAATTTTATTACAACAGCAATCAATATACGATCAGAAAGAATAACATTAGACCAAACACCATTATTTGTTTGATCAGTAGTTATTACAGCACTCCTTTTATTATTATCACTTCCTGTACTAGCAGGAGCTATTACAATATTACTAACTGACCGAAACTTAAATACATCATTCTTCGATCCTGCAGGAGGGGGTGACCCAATTCTATATCAACATTTATTTTGATTTT,,, "",44.9830000000,-93.1900000000,09/04/2025,"

Found in the grass of my front yard! There were also other wasps like it nearby.<\/p>\n",Hymenoptera,DNeasy (Qiagen) blood and tissue kit.,Abdomen,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_1629-scaled.jpeg,","

Followed Wolbachia Project protocols.<\/p>\n",Unknown,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_7175.jpg,",44.9188377260,-93.1967000000,09/07/2025,"

I was given this cricket by my sister because she had a lot of them for feeding her pet leopard gecko. They were purchased from Petco. It was kept at room temperature in the store. I do not know where Petco gets all of these crickets.<\/p>\n",Acheta domesticus,DNeasy (Qiagen) blood and tissue kit.,Abdomen,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-27-143200.png,","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_3114-1.png,",44.9300000000,93.1700000000,09/08/2025,"

Collected on tennis courts, near a grassy area, in temperatures around 75 degrees Fahrenheit.<\/p>\n",Hymenoptera,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,agarose gel electrophoresis,,,"","",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_6050-1-scaled.jpeg,",44.9259872430,-93.1729431100,09/08/2025,"

I found this ant after school on the sidewalk this fall with other ants.<\/p>\n",Hymenoptera,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,SeaGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_6099.jpeg,","

Followed Wolbachia project protocols<\/p>\n",Yes,,,, "",42.4839959,-71.1424871,09/17/2025,"

This insect was found underneath a bag of soil. It was living in a moist, and dark habitat. It was living in a group along with other insects.<\/p>\n",Isopoda,tweezers,Abdomen,,,,"","",Unknown,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_6448-1.jpeg,",44.9300000000,93.1700000000,09/08/2026,"

This Spider was collected in a garden from its web on a soil bed. In temperatures of around 70-76 degrees and it was mostly sunny.<\/p>\n",Araneae,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-25-200019.png,","

Followed Wolbachia Project Protocols<\/p>\n",No,,,, "",44.9200000000,-93.1900000000,09/08/2025,"

Found near a wall in the cracks of a brick tile with sand, during the fall in 74 degree weather<\/p>\n",Opiliones,pcr,Whole arthropod,agarose gel electrophoresis,,,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/wolbachia-scaled.jpg,","",No,,,, "",,,,"",,,,,,,"","",,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_9522.jpeg,",445628.0000000000,930924.0000000000,09/05/2025,"

Absolutely tiny black ants living in a colony of thousands in dirt and woodchips next a man made pond near a house. Similar ants have been seen making colonies of similar size in sidewalk just around the block. Tiny black ants with large abdomen connected with small nodes. Thorax is larger compared to the abdomen than one of a little black ant, giving me confidence that this is a pavement ant<\/p>\n",Tetramorium immigrans,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_9621-1.jpeg,","

Followed Wolbachia Project Protocols<\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_6703-scaled.jpeg,",43.1440000000,-88.5310000000,09/20/2025,"

I found this centipede in the dirt outside of Camp OSRUI in Wisconsin. It was located near a basketball court and several cabins in a grassy area surrounded by trees. It has a long body, numerous legs, orange antennae, and a yellowish hue.<\/p>\n",Geophilomorpha,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,agarose gel electrophoresis,TBE,Other,"","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_1219-scaled.jpeg,",44.9419740000,-93.1642280000,09/09/2025,"",Plodia interpunctella,DNeasy (Qiagen),Larva,agarose gel electrophoresis,TBE,Other,"","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/unnamed-2-1.jpg,",44.9300000000,-93.1700000000,09/04/2025,"

I found the greenhouse millipede under a potted plant in my front yard. He was found on dirt in a warm environment. He has a mixed complexion of brown and black and many legs. He was found during the fall season in a high 50’s degrees farenheight climate.<\/p>\n",Polydesmida,DNeasy (Qiagen) blood and tissue kit.,Whole arthropod,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-27-090532.png,","

Followed Wolbachia project protocol.<\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_2217-scaled.jpeg,",931019.0000000000,445532.0000000000,09/09/2025,"

I collected it around 10 am, when it was 75(ish) degrees and sunny. It was found walking around on dirt surrounded by lots of plats and trees. It has 6 legs, head, thorax, abdomen, no hair, no wings, and antennae.<\/p>\n",Hymenoptera,DNeasy (Qiagen) blood and tissue kit,Abdomen,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_2348-scaled.jpeg,","

followed Wolbachia project protocols<\/p>\n",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_0972-1-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_0975-scaled.jpeg,",450215.0000000000,930958.0000000000,09/05/2025,"

It has a black, tough exoskeleton and light brown legs. Also has six legs and two antennae.<\/p>\n",Coleoptera,Qiagen Blood and Tissue kit,Abdomen,agarose gel electrophoresis,,,"","",No,,,, "",,,,"",,,,,,,"","",,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_0904-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_0905-scaled.jpg,",44.9263134000,-93.1746431000,08/07/2025,"

The bug is black, with orange and yellowish patterns on its back. It was found in a dark and cooler place.<\/p>\n",Boisea trivittata,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,SeaGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-22-144056.png,","

Followed Wolbachia Project Protocols<\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/PXL_20251107_134339085.MACRO_FOCUS.jpg,",,,09/18/2025,"",Syrphidae,DNeasy (Qiagen),Abdomen,MiniOne,1X TAE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/PXL_20251124_184919308-1-1-scaled.jpg,","",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/PXL_20251107_134421850.MACRO_FOCUS.jpg,",,,09/18/2025,"",Arthropoda,DNeasy (Qiagen),Abdomen,MiniOne,1X TAE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/PXL_20251124_184919308-1-scaled.jpg,","",Yes,,,, "",420524.0000000000,723013.0000000001,09/17/2025,"",Limoniidae,DNeasy (Qiagen),Abdomen,MiniOne,1X TAE,GelGreen,"","",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_7078-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_7081-scaled.jpeg,",40.5200000000,74.4950000000,09/29/2025,"

Cloudy, 62 degrees F, 1:50 pm, Found in the woodchips outside, Caught with the container.<\/p>\n",Lycorma,DNeasy (Qiagen) blood and tissue kit,Partial abdomen,Edvotek Gel Electrophoresis,1X TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_7315-scaled.jpeg,","

Standard Protocol<\/p>\n",No,,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/N8-CO1_SLF_43F.fasta,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_3790-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_3789-scaled.jpeg,",40.5200000000,74.4950000000,09/29/2025,"

Cloudy, 62 degrees F, 1:45 pm, Found in woodchips outside, Caught with the container off of the woodchip.<\/p>\n",Lycorma,DNeasy (Qiagen) blood and tissue kit.,Partial abdomen,Edvotek Gel Electrophoresis,1X TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_7315-scaled.jpeg,","

Standard Protocol<\/p>\n",Unknown,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_4499.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_4500.jpeg,",,,09/25/2025,"

Found in the art room<\/p>\n

classification :Yellowjacket and hornets<\/p>\n",Arthropoda,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,Standard electrophoresis system Bio-Rad,1X TAE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/ae6cd662ccded6a024ab91943090c2d6.jpeg,","

DNA was extracted from the whole bee using the Qiagen DNeasy Blood and Tissue Kit. PCR was performed using arthropod primers (708\u202fbp) and Wolbachia primers (438\u202fbp). Gel electrophoresis with 1X TAE buffer and GelGreen stain confirmed DNA extraction and PCR results. Arthropod DNA was detected, but Wolbachia was not present<\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_3777-scaled.jpeg,",40.5200000000,74.4950000000,09/29/2025,"

Cloudy, 62 degrees F, 1:51pm, slight wind. Found on the ground by gazebo. Caught on dirt and grass.<\/p>\n",Armadillidium,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,Edvotek Gel Electrophoresis,1X TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/tempImageXGYDFQ-scaled.jpg,","

Standard protocol<\/p>\n",Yes,,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/N6-CO1F.fasta,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_7077-scaled.jpeg,",40.5200000000,74.4950000000,09/29/2025,"

Cloudy, 62 degrees F, 1:35 pm, found in the grass outside, caught with tweezers.<\/p>\n",Velarifictorus,DNeasy (Qiagen) blood and tissue kit,Partial abdomen,Edvotek Gel Electrophoresis,1X TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_7315-scaled.jpeg,","

Standard protocol<\/p>\n",Unknown,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_3822-scaled.jpeg,",40.5200000000,74.4950000000,09/29/2025,"

Cloudy, 62 degrees F, 1:50pm, slight wind. Found on the ground by gazebo. Caught on dirt and grass.<\/p>\n",Armadillidium,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,Edvotek Gel Electrophoresis,1X TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/tempImageXGYDFQ-scaled.jpg,","

Standard protocol<\/p>\n",No,,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/N5-CO1F.fasta,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_9120-scaled.jpg,",40.525790598,-74.49429463,09/25/2025,"",Formicidae,DNeasy (Qiagen) blood and tissue kit,Abdomen,Edvotek Gel Electrophoresis,TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_1539-2.jpg,","",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_9125-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_9126-scaled.jpeg,",40.526215000,-74.49421500,09/25/2025,"

Found in a playground, near a gaga pit around 8:30 in the morning.<\/p>\n",Trichoptera,Qiagen DNeasy Blood and Tissue Kit,Abdomen,Edvotek Gel Electrophoresis,TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_1539.jpg,","",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_7076-scaled.jpeg,",40.5200000000,74.4950000000,09/25/2025,"

Cloud, 62 degrees F, 1:27 pm, Found in the grass outside, Caught with tweezers.<\/p>\n",Velarifictorus,DNeasy (Qiagen) blood and tissue kit,Partial abdomen,Edvotek Gel Electrophoresis,1X TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_7315-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_7342-scaled.jpeg,","

Standard protocol<\/p>\n",Yes,,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/N10-CO1F-2.fasta,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_3788-scaled.jpeg,",40.5200000000,74.4950000000,09/25/2025,"

It was wet & cloudy, under damp rock, near a path, temp 72 degree F, 8:45 am, near Raritan river.<\/p>\n",Armadillidium,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,Edvotek Gel Electrophoresis,1X TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/tempImageXGYDFQ-scaled.jpg,","

Standard protocol<\/p>\n",Unknown,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_9122-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_9121-scaled.jpeg,",40.5262150000,-74.4942150000,09/25/2025,"

Found under the Rutgers Prep playground slide, around 8:45 in the morning.<\/p>\n",Lepidoptera,Qiagen DNeasy Blood and Tissue Kit,Abdomen,Edvotek Gel Electrophoresis,TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_1539.jpg,","",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_9123-scaled.jpg,",40.5257905980,-74.4942946300,,"",Araneae,DNeasy (Qiagen) blood and tissue kit,Abdomen,Edvotek Gel Electrophoresis,TAE,Ethidium Bromide,"","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_3786-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_3785-scaled.jpeg,",40.5200000000,74.4950000000,09/29/2025,"

Cloudy, 62 degrees F, 1:16 pm, slight wind. Found on the ground by gazebo. Caught on dirt and grass.<\/p>\n",Vespidae,DNeasy (Qiagen) blood and tissue kit,Partial abdomen,Edvotek Gel Electrophoresis,1X TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_7315-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_7342-scaled.jpeg,","

Standard protocol<\/p>\n",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/20250926_130247-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/20250926_130233-scaled.jpg,",40.3137200000,74.2941500000,09/28/2025,"",Hymenoptera,DNeasy (Qiagen) blood and tissue kit,,Edvotek Gel Electrophoresis,TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_1539-2.jpg,","",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_3793-scaled.jpeg,",40.5200000000,74.4950000000,09/25/2025,"

It was wet & cloudy, under damp rock, near a path, temp 72 degree F, 8:45 am, near Raritan river.<\/p>\n",Armadillidium,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,Edvotek Gel Electrophoresis,1X TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/tempImageXGYDFQ-scaled.jpg,","

Standard protocol<\/p>\n",No,,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/N3-CO1F.fasta,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_3784-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_3783-scaled.jpeg,",40.52,74.495,09/29/2025,"

Cloudy, 62 degrees F, 1:16 pm, slight wind. Found on the ground by gazebo. Caught on dirt and grass.<\/p>\n",Vespidae,DNeasy (Qiagen) blood and tissue kit,Partial abdomen,Edvotek Gel Electrophoresis,1X TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_7315-scaled.jpeg,","

Standard protocol<\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/20250926_130500-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/20250926_130509-scaled.jpg,",40.3137200000,74.2941500000,09/28/2026,"",Hymenoptera,DNeasy (Qiagen) blood and tissue kit,Abdomen,Edvotek Gel Electrophoresis,TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_1539-2.jpg,","",Yes,,,, "",,,09/25/2025,"

Caught from nest located outside of the art room on campus.<\/p>\n",Dolichovespula,DNeasy (Qiagen) blood and tissue kit,Abdomen,Edvotek Gel Electrophoresis,1X TAE,Ethidium Bromide,"","",Yes,,,, "",,,09/08/2025,"

I caught this spider in the bushes outside in the lunch area at my school. I remember the spider being about the length from the tip of my thumb to the first joint counting its legs, although I may be remembering it bigger than it was. It was a sunny day in September if I recall correctly, and it was early in the afternoon.<\/p>\n",Araneus diadematus,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Wolbachia-gels.jpg,","",No,,,, "",44.95,-93.09,09/08/2025,"

This bug was caught in the fall it was a bit cold out, I found it near the sidewalk. There were many ants but I chose just one.<\/p>\n",Formicidae,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2025-11-13-132023.png,","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_1534-scaled.jpg,",40.5265994190,-74.4949637800,09/29/2025,"",Hemiptera,DNeasy (Qiagen) blood and tissue kit,Abdomen,Edvotek Gel Electrophoresis,TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_1539-1.jpg,","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_3792-scaled.jpeg,",40.5200000000,74.4950000000,09/25/2025,"

It was wet & cloudy, under damp rock, near a path, temp 72 degrees F, 8:45 am, near Raritan River.<\/p>\n",Armadillidium,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,Edvotek Gel Electrophoresis,1X TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/tempImageXGYDFQ-scaled.jpg,","

standard protocol<\/p>\n",No,,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/N2-CO1F.fasta,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_9119-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_9117-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_9118-scaled.jpeg,",40.526215000,-74.49421500,09/25/2025,"

Found near a pond, under a rock around 8:30 in the morning.<\/p>\n",Armadillidae,DNeasy (Qiagen) blood and tissue kit,Abdomen,Edvotek Gel Electrophoresis,TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_1539.jpg,","",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_9119-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_9117-scaled.jpeg,",40.5262150000,-74.4942150000,09/25/2025,"

Found near a pond, under a rock around 8:30 in the morning.<\/p>\n",Armadillidae,DNeasy (Qiagen) blood and tissue kit,Abdomen,Edvotek Gel Electrophoresis,TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_1539.jpg,","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_9119-scaled.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_9118-scaled.jpeg,",40.5262150000,-74.4942150000,09/25/2025,"

Found near a pond, under a rock around 8:30 in the morning.<\/p>\n",Armadillidae,DNeasy (Qiagen) blood and tissue kit,Abdomen,Edvotek Gel Electrophoresis,TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_1539.jpg,","",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_3796-scaled.jpeg,",40.5200000000,74.4950000000,09/25/2025,"

It was wet & cloudy, under damp rock, near a path, temp 72 degrees F, 8:45 am, near Raritan river<\/p>\n",Armadillidium,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,Edvotek Gel Electrophoresis,1X TAE,Ethidium Bromide,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/tempImageXGYDFQ-scaled.jpg,","

standard protocol<\/p>\n",Unknown,,,, "",,,09/08/2025,"

I found this stinkbug on a leaf in a bush at school. I collected it around 12 pm, and it was a warm sunny day.<\/p>\n",Halyomorpha,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,GelGreen,"","

\"\"<\/p>\n",No,,,, "",,,09/08/2025,"

Found in a grass field at school. I collected it around noon in sunny, clear weather.<\/p>\n",Melanoplus femurrubrum,DNeasy (Qiagen) blood and tissue kit,Abdomen,MiniPCR,TBE,GelGreen,"","",No,,,, "",44.9252967,-93.1743526,09/08/2025,"

I collected this wasp near the outdoor lunch seating area at my school. It was about 75 degrees F and sunny, at about 12:30 p.m. It was one of 10 or so wasps in that area at that time.<\/p>\n",Hymenoptera,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/unnamed-5.jpg,","",No,,,, "",44.9264020830,-93.1733500000,08/27/2025,"

I collected the ladybug by the school at around noon. I picked it off a leaf of a bush as the ground was damp.<\/p>\n",Harmonia axyridis,DNeasy (Qiagen) blood and tissue kit,Abdomen,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-08-173602.png,","",No,,,, "",44.926538278,-93.17302299,09/08/2025,"

I found this flesh fly by some bushes in the school courtyard. I collected it around noon, when it was around 70 degrees and sunny outside.<\/p>\n",Sarcophagidae,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-08-145811.png,","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_0583-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-27-142825.png,",931027.0000000000,445534.0000000000,09/11/2025,"

6 legs, head, torso, thorax<\/p>\n",Hymenoptera,,,,,,"","",No,,,, "",44.9500000000,-93.0900000000,09/08/2025,"

it was summer and I found it on a fern near some grass<\/p>\n",Harmonia axyridis,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-08-094458.png,","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_3327-scaled.jpg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_3328-scaled.jpg,",44.7900000000,93.5200000000,09/04/2025,"

Looks like a wasp, 4 legs, 2 anteaneas, the abdomen is the biggest part.<\/p>\n",Hymenoptera,DNeasy (Qiagen) blood and tissue kit,Abdomen,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/IMG_3388-scaled.jpg,","",No,,,, "",,,09/08/2025,"",Polydesmida,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/unnamed-3.jpg,","",No,,,, "",44.9625180000,-93.2088560000,09/04/2025,"

\"\"\"\"<\/p>\n

The millipede was found under a rock in a garden. It was collected in the afternoon on September 4th, the temperature was high 50s Fahrenheit. There was many other smaller insects under the rocks, but only one millipede was collected.<\/p>\n",Polydesmida,Qiagen DNeasy Blood and Tissue Kit,Whole arthropod,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-27-090403.png,","

Followed Wolbachia Project Protocols<\/p>\n",No,,,, "",93.1743000000,44.9262000000,09/08/2025,"

I found this Japanese beetle in the flowers by the school courtyard. I collected it during midday, around noon. It was sunny and 65 degrees out. This was the only Japanese beetle in the area.<\/p>\n",Coleoptera,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,GelGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-07-100723.png,","",No,,,, "",,,10/16/2025,"

\"\"<\/p>\n",Lepidoptera,pcr,Abdomen,MiniPCR,1X TAE,UView,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screen-Shot-2026-01-05-at-11.03.38-AM.png,","

    \n
  1. lace the gel tray containing your gel in the buffer chamber<\/span>\n
      \n
    1. Ensure that the clear buffer chamber is inside the blueGel electrophoresis system.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

       <\/p>\n

        \n
      1. The wells of the gel should be on the same side as the negative electrode, away from the power button.<\/span><\/li>\n<\/ol>\n

         <\/p>\n

          \n
        1. Use a graduated cylinder to add 30 ml of 1X TBE electrophoresis buffer<\/span>\n
            \n
          1. The buffer should just cover the gel and wells.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

             <\/p>\n

              \n
            1. Ensure that there are no air bubbles in the wells (shake the gel gently if bubbles need to be dislodged).<\/span><\/li>\n<\/ol>\n

               <\/p>\n

                \n
              1. Starting with the ladder in lane 1, gently hover your pipette tip over the well, and load 5 uL. Follow the loading key in the table below to load the rest of your gel. Remember to change tips between each sample.\u00a0<\/span><\/li>\n<\/ol>\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n
                Lane<\/b><\/td>\nSample<\/b><\/td>\n<\/tr>\n
                1<\/span><\/td>\nDNA Ladder<\/span><\/td>\n<\/tr>\n
                2<\/span><\/td>\nArthropod Sample #1<\/span><\/td>\n<\/tr>\n
                3<\/span><\/td>\nArthropod Sample #2<\/span><\/td>\n<\/tr>\n
                4<\/span><\/td>\nArthropod (+) Control (A #3)<\/span><\/td>\n<\/tr>\n
                5<\/span><\/td>\nArthropod (-) Control (A #4)<\/span><\/td>\n<\/tr>\n
                6<\/span><\/td>\n(+) DNA Control (A #5)<\/span><\/td>\n<\/tr>\n
                7<\/span><\/td>\n(-) DNA Control (A #6)<\/span><\/td>\n<\/tr>\n
                8<\/span><\/td>\nWolbachia Sample #1<\/span><\/td>\n<\/tr>\n
                9<\/span><\/td>\nWolbachia Sample #2<\/span><\/td>\n<\/tr>\n
                10<\/span><\/td>\nWolbachia (+) Control (W #3)<\/span><\/td>\n<\/tr>\n
                11<\/span><\/td>\nWolbachia (-) Control (W #4)<\/span><\/td>\n<\/tr>\n
                12<\/span><\/td>\n(+) DNA Control (W #5)<\/span><\/td>\n<\/tr>\n
                13<\/span><\/td>\n(-) DNA Control (W #6)<\/span><\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                 <\/p>\n

                  \n
                1. Place the orange cover on the blueGel electrophoresis system<\/span>\n
                    \n
                  1. Match the positive and negative electrode signs on the orange lid with the corresponding positive and negative signs on the blue base.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                     <\/p>\n

                      \n
                    1. The orange lid should sit flush with the blue base using little force.<\/span><\/li>\n<\/ol>\n

                       <\/p>\n

                        \n
                      1. Press the \u201cRun\u201d button<\/span>\n
                          \n
                        1. Check that the green light beside the power button remains illuminated.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                           <\/p>\n

                            \n
                          1. Conduct electrophoresis for 20-25 minutes<\/span>\n
                              \n
                            1. The colored dye should progress to about half the length of the gel.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                               <\/p>\n

                                \n
                              1. Longer electrophoresis times will result in better size resolution.<\/span><\/li>\n<\/ol>\n

                                 <\/p>\n

                                  \n
                                1. Press the \u201clight bulb\u201d button to turn on the blueGel transilluminator.<\/span>\n
                                    \n
                                  1. For best viewing, place the viewing chamber over the blueGel machine.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                     <\/p>\n

                                      \n
                                    1. Gels may be viewed at the end of the run or periodically throughout the run.<\/span><\/li>\n<\/ol>\n

                                       <\/p>\n

                                        \n
                                      1. Ensure that the bands in your gel have separated enough to clearly interpret your results<\/span>\n
                                          \n
                                        1. Run the gel longer if needed to increase resolution.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                           <\/p>\n

                                            \n
                                          1. Take a picture and insert it in the correct post-lab question<\/span><\/li>\n<\/ol>\n",Yes,,,, "",,,,"",,,,,,,"","",,,,, "",44.6394916725,-93.1366273332,09/25/2025,"

                                            It was at a school, with a bunch of flowers in the area. The bee was medium-sized about the length of a quarter.<\/p>\n",Hymenoptera,DNeasy (Qiagen) blood and tissue kit,Abdomen,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2025/12/Screenshot-2025-12-09-101122.png,","

                                            Found in lanes 4 and 5.<\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-06-124005.png,",,,09/08/2025,"

                                            It has a head that is relatively separated from the abdomen. There are six legs and it has antennae. The thorax is thin.<\/p>\n",Hymenoptera,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,Cyber Green,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-27-122522.png,","

                                            Followed Wolbachia Project Protocols<\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Image_20251219_095816_086-scaled.jpeg,",,,10/06/2025,"

                                            It was a small brown moth, bigger than a fly.<\/p>\n",Lepidoptera,DNeasy (Qiagen) blood and tissue kit,Abdomen,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Image_20251218_095346_108-1-scaled.jpeg,","

                                             <\/p>\n

                                            Day 1:<\/b><\/p>\n

                                            Sample Preparation<\/span><\/i><\/p>\n

                                              \n
                                            1. Label each of your tubes with 1-4 and your initials. You should have 2 tubes labeled for each number. (2 Tube 1\u2019s, 2 Tube 2\u2019s, 2 Tube 3\u2019s, and 2 Tube 4\u2019s). You will be using the first set of tubes for this <\/span>Sample Preparation<\/span><\/i> section. Record what you will be putting into each tube in the table below.<\/span><\/span>\n
                                                \n
                                              1. Use tweezers to carefully transfer the first arthropod to a Petri dish. Rinse with water using a pipette and blot dry excess liquid with a paper towel. Take 1-2 pictures for the The Wolbachia Project Database. If the arthropod is smaller than a grain of rice, skip to Step 5.<\/span><\/li>\n<\/ol>\n

                                                \u00a0<\/span><\/span><\/p>\n\n\n\n
                                                \n
                                                  \n
                                                1. Remove the abdomen of the arthropod and cut off a small piece (roughly ~2 mm, or small enough to fit in the bottom of a microcentrifuge tube).<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n
                                                  \n
                                                1. Remove as much preservative and water as possible. If the arthropod is large or has a thick\/tough exoskeleton, dissect out the reproductive tissues. Arthropods with a thick exoskeleton should be cut into multiple pieces.<\/span><\/li>\n<\/ol>\n

                                                   <\/p>\n\n\n\n
                                                  \n
                                                    \n
                                                  1. Place the specimen into a labeled 1.5 ml microcentrifuge tube and repeat for remaining arthropods.<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                  <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                  Cell Lysis & DNA Precipitation<\/span><\/i><\/p>\n

                                                    \n
                                                  1. Add <\/span>180 \u03bcl Buffer ATL<\/b> to the first tube. Buffer ATL is a tissue lysis buffer.<\/span><\/li>\n<\/ol>\n

                                                     <\/p>\n\n\n\n
                                                    \n
                                                      \n
                                                    1. Use a sterile pestle to grind the sample for 1 minute. This is the most critical step of the entire procedure, as it is necessary to obtain high DNA yield. Grind each sample thoroughly.<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                    <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                     <\/p>\n\n\n\n
                                                    \n
                                                      \n
                                                    1. Using a new pestle for each tube; repeat Steps 6 and 7 with remaining samples.<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                    <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n
                                                      \n
                                                    1. Add <\/span>20 \u03bcl Proteinase K<\/b> to each tube. Proteinase K will destroy DNases that break down DNA.<\/span><\/li>\n<\/ol>\n

                                                       <\/p>\n\n\n\n
                                                      \n
                                                        \n
                                                      1. Add <\/span>200 \u03bcl Buffer AL<\/b> to each tube and immediately mix by vortexing for 10 seconds. Buffer AL lyses open cells.<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                      <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n
                                                        \n
                                                      1. Incubate in the water bath for at least 15 minutes or longer at 56 \u00b0C.\u00a0<\/span><\/li>\n<\/ol>\n

                                                         <\/p>\n\n\n\n
                                                        \n
                                                          \n
                                                        1. Place the tubes in the centrifuge and spin the tubes for about 30 seconds to pellet debris.\u00a0<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                        <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                         <\/p>\n\n\n\n
                                                        \n
                                                          \n
                                                        1. Using a new tip for each sample, transfer the liquid lying above the pellet (~400 \u03bcl) to the other 1.5 ml tube with the same number label. Do not disturb the pellet.\u00a0<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                        <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                         <\/p>\n\n\n\n
                                                        \n
                                                          \n
                                                        1. Discard the old tube of pellet debris and keep the liquid. Repeat steps 13 and 14 for other samples.\u00a0<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                        <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                         <\/p>\n\n\n\n
                                                        \n
                                                          \n
                                                        1. Add <\/span>200 \u03bcl ethanol<\/b> to each tube and mix by vortexing for 10 seconds. Ethanol precipitates DNA.<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                        <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n
                                                          \n
                                                        1. Store DNA in the refrigerator until next class.<\/span><\/li>\n<\/ol>\n

                                                           <\/p>\n

                                                          Day 2:<\/b><\/p>\n

                                                          DNA Purification<\/span><\/i><\/p>\n\n\n\n
                                                          \n
                                                            \n
                                                          1. Collect four DNeasy spin columns fitted with four 2.0 ml collection tubes and label the lids of the spin columns with 1-4. <\/span>NOTE<\/b>: The Spin Column sits inside the Flow Through tubes. DO NOT SEPARATE the Spin Column from the Flow Through tube.\u00a0<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                          <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                           <\/p>\n\n\n\n
                                                          \n
                                                            \n
                                                          1. Pipet (or carefully pour) the liquid from Tube 1 from yesterday (including any precipitate) into the spin column #1. Using a new pipette tip for each transfer, repeat this process with the three other tubes. Make sure to keep the tube numbers consistent. Throughout the procedure, be careful not to touch the filter or get liquid around the rim of the column.<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                          <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                           <\/p>\n\n\n\n
                                                          \n
                                                            \n
                                                          1. Centrifuge all tubes for 1 minute. The DNA is now caught in the filter of the spin column.\u00a0<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                          <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                           <\/p>\n\n\n\n
                                                          \n
                                                            \n
                                                          1. Carefully remove the spin columns from the collection tubes and discard the flow through (liquid) from the 2.0 ml collection tubes into the waste cup. Replace the spin columns back into their emptied collection tubes.<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                          <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                           <\/p>\n\n\n\n
                                                          \n
                                                            \n
                                                          1. Add <\/span>500 \u03bcl of Buffer AW1<\/b> to each spin column. Use caution to not touch the white membrane with your pipette tips. Buffer AW1 washes the DNA.<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                          <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                           <\/p>\n\n\n\n
                                                          \n
                                                            \n
                                                          1. Centrifuge all tubes for 1 minute.<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                          <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                           <\/p>\n\n\n\n
                                                          \n
                                                            \n
                                                          1. Again, discard the flow through waste from the 2.0 ml collection tubes into the waste cup and place the spin columns back into the same 2.0 ml collection tubes.<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                          <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                           <\/p>\n\n\n\n
                                                          \n
                                                            \n
                                                          1. Add <\/span>500 \u03bcl Buffer AW2<\/b> (a second wash buffer) to each of the four tubes and centrifuge for 3 minutes to dry the spin column membrane.<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                          <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n
                                                            \n
                                                          1. Allow the tube to air dry for 2 minutes. This will evaporate the leftover ethanol. While you are waiting, label 4 new 1.5 ml microcentrifuge tubes with 1-4 and your initials.\u00a0<\/span><\/li>\n<\/ol>\n

                                                             <\/p>\n

                                                            DNA Elution<\/span><\/i><\/p>\n\n\n\n
                                                            \n
                                                              \n
                                                            1. Carefully remove the spin column so that it does not make contact with residual ethanol in the tube. If ethanol is still present on the membrane, empty the collection tube and spin again. Place each spin column into the corresponding 1.5 ml microcentrifuge tube.<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                            <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                             <\/p>\n\n\n\n
                                                            \n
                                                              \n
                                                            1. Pipet <\/span>100 \u03bcl of Buffer AE<\/b> directly onto the spin column membrane. Let sit at room temperature for 1 minute. Buffer AE is an elution buffer that rinses the DNA off the spin column filter and into the 1.5 ml tube.<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                            <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                             <\/p>\n\n\n\n
                                                            \n
                                                              \n
                                                            1. Centrifuge for 1 minute. <\/span>NOTE<\/b>: At this point, you will have two sets of lids. When you place them in the centrifuge, keep the lids down against the center of the centrifuge, not sticking out. The eluted DNA will be collected in the 1.5 ml tube.<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                            <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                             <\/p>\n\n\n\n
                                                            \n
                                                              \n
                                                            1. Discard the spin columns and <\/span>KEEP the labeled 1.5 ml tubes<\/span><\/i>. The DNA is now in the 1.5 ml microcentrifuge tubes.<\/span><\/li>\n<\/ol>\n<\/td>\n
                                                            <\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n
                                                              \n
                                                            1. Store the DNA tubes frozen at -20 C until PCR.<\/span><\/li>\n<\/ol>\n

                                                               <\/li>\n<\/ol>\n",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/wolbach-2.jpg,",,,10/06/2025,"

                                                              We took a standard size fly and removed the inside of the abdomen.\u00a0 We are unsure whether wolbachia is present or not.<\/p>\n",Musca domestica,DNeasy (Qiagen) blood and tissue kit,Abdomen,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/wolbach-3.jpg,","

                                                                \n
                                                              1. Place the gel tray containing your gel in the buffer chamber<\/span>\n
                                                                  \n
                                                                1. Ensure that the clear buffer chamber is inside the blueGel electrophoresis system.<\/span><\/li>\n<\/ol>\n<\/li>\n
                                                                2. The wells of the gel should be on the same side as the negative electrode, away from the power button.<\/span><\/li>\n
                                                                3. Use a graduated cylinder to add 30 ml of 1X TBE electrophoresis buffer<\/span>\n
                                                                    \n
                                                                  1. The buffer should just cover the gel and wells.<\/span><\/li>\n<\/ol>\n<\/li>\n
                                                                  2. Ensure that there are no air bubbles in the wells (shake the gel gently if bubbles need to be dislodged).<\/span><\/li>\n
                                                                  3. Starting with the ladder in lane 1, gently hover your pipette tip over the well, and load 5 uL. Follow the loading key in the table below to load the rest of your gel. Remember to change tips between each sample.\u00a0<\/span><\/li>\n<\/ol>\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n
                                                                    Lane<\/b><\/td>\nSample<\/b><\/td>\n<\/tr>\n
                                                                    1<\/span><\/td>\nDNA Ladder<\/span><\/td>\n<\/tr>\n
                                                                    2<\/span><\/td>\nArthropod Sample #1<\/span><\/td>\n<\/tr>\n
                                                                    3<\/span><\/td>\nArthropod Sample #2<\/span><\/td>\n<\/tr>\n
                                                                    4<\/span><\/td>\nArthropod (+) Control (A #3)<\/span><\/td>\n<\/tr>\n
                                                                    5<\/span><\/td>\nArthropod (-) Control (A #4)<\/span><\/td>\n<\/tr>\n
                                                                    6<\/span><\/td>\n(+) DNA Control (A #5)<\/span><\/td>\n<\/tr>\n
                                                                    7<\/span><\/td>\n(-) DNA Control (A #6)<\/span><\/td>\n<\/tr>\n
                                                                    8<\/span><\/td>\nWolbachia Sample #1<\/span><\/td>\n<\/tr>\n
                                                                    9<\/span><\/td>\nWolbachia Sample #2<\/span><\/td>\n<\/tr>\n
                                                                    10<\/span><\/td>\nWolbachia (+) Control (W #3)<\/span><\/td>\n<\/tr>\n
                                                                    11<\/span><\/td>\nWolbachia (-) Control (W #4)<\/span><\/td>\n<\/tr>\n
                                                                    12<\/span><\/td>\n(+) DNA Control (W #5)<\/span><\/td>\n<\/tr>\n
                                                                    13<\/span><\/td>\n(-) DNA Control (W #6)<\/span><\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                                     <\/p>\n

                                                                      \n
                                                                    1. Place the orange cover on the blueGel electrophoresis system<\/span>\n
                                                                        \n
                                                                      1. Match the positive and negative electrode signs on the orange lid with the corresponding positive and negative signs on the blue base.<\/span><\/li>\n<\/ol>\n<\/li>\n
                                                                      2. The orange lid should sit flush with the blue base using little force.<\/span><\/li>\n
                                                                      3. Press the \u201cRun\u201d button<\/span>\n
                                                                          \n
                                                                        1. Check that the green light beside the power button remains illuminated.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n
                                                                            \n
                                                                          1. Conduct electrophoresis for 20-25 minutes<\/span>\n
                                                                              \n
                                                                            1. The colored dye should progress to about half the length of the gel.<\/span><\/li>\n<\/ol>\n<\/li>\n
                                                                            2. Longer electrophoresis times will result in better size resolution.<\/span><\/li>\n
                                                                            3. Press the \u201clight bulb\u201d button to turn on the blueGel transilluminator.<\/span>\n
                                                                                \n
                                                                              1. For best viewing, place the viewing chamber over the blueGel machine.<\/span><\/li>\n<\/ol>\n<\/li>\n
                                                                              2. Gels may be viewed at the end of the run or periodically throughout the run.<\/span><\/li>\n
                                                                              3. Ensure that the bands in your gel have separated enough to clearly interpret your results<\/span>\n
                                                                                  \n
                                                                                1. Run the gel longer if needed to increase resolution.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n
                                                                                    \n
                                                                                  1. Take a picture and insert it in the correct post-lab question.<\/span><\/li>\n<\/ol>\n",Unknown,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/wolbach.jpg,",,,10/06/2025,"

                                                                                    The bright yellow lines signify the presence of wolbachia. It appears that our first arthropod (A1) does not show signs of wolbachia. The first arthropod is a small black gnat (diptera).<\/p>\n",Diptera,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/wolbach-1.jpg,","

                                                                                      \n
                                                                                    1. Place the gel tray containing your gel in the buffer chamber<\/span>\n
                                                                                        \n
                                                                                      1. Ensure that the clear buffer chamber is inside the blueGel electrophoresis system.<\/span><\/li>\n<\/ol>\n<\/li>\n
                                                                                      2. The wells of the gel should be on the same side as the negative electrode, away from the power button.<\/span><\/li>\n
                                                                                      3. Use a graduated cylinder to add 30 ml of 1X TBE electrophoresis buffer<\/span>\n
                                                                                          \n
                                                                                        1. The buffer should just cover the gel and wells.<\/span><\/li>\n<\/ol>\n<\/li>\n
                                                                                        2. Ensure that there are no air bubbles in the wells (shake the gel gently if bubbles need to be dislodged).<\/span><\/li>\n
                                                                                        3. Starting with the ladder in lane 1, gently hover your pipette tip over the well, and load 5 uL. Follow the loading key in the table below to load the rest of your gel. Remember to change tips between each sample.\u00a0<\/span><\/li>\n<\/ol>\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n
                                                                                          Lane<\/b><\/td>\nSample<\/b><\/td>\n<\/tr>\n
                                                                                          1<\/span><\/td>\nDNA Ladder<\/span><\/td>\n<\/tr>\n
                                                                                          2<\/span><\/td>\nArthropod Sample #1<\/span><\/td>\n<\/tr>\n
                                                                                          3<\/span><\/td>\nArthropod Sample #2<\/span><\/td>\n<\/tr>\n
                                                                                          4<\/span><\/td>\nArthropod (+) Control (A #3)<\/span><\/td>\n<\/tr>\n
                                                                                          5<\/span><\/td>\nArthropod (-) Control (A #4)<\/span><\/td>\n<\/tr>\n
                                                                                          6<\/span><\/td>\n(+) DNA Control (A #5)<\/span><\/td>\n<\/tr>\n
                                                                                          7<\/span><\/td>\n(-) DNA Control (A #6)<\/span><\/td>\n<\/tr>\n
                                                                                          8<\/span><\/td>\nWolbachia Sample #1<\/span><\/td>\n<\/tr>\n
                                                                                          9<\/span><\/td>\nWolbachia Sample #2<\/span><\/td>\n<\/tr>\n
                                                                                          10<\/span><\/td>\nWolbachia (+) Control (W #3)<\/span><\/td>\n<\/tr>\n
                                                                                          11<\/span><\/td>\nWolbachia (-) Control (W #4)<\/span><\/td>\n<\/tr>\n
                                                                                          12<\/span><\/td>\n(+) DNA Control (W #5)<\/span><\/td>\n<\/tr>\n
                                                                                          13<\/span><\/td>\n(-) DNA Control (W #6)<\/span><\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                                                           <\/p>\n

                                                                                            \n
                                                                                          1. Place the orange cover on the blueGel electrophoresis system<\/span>\n
                                                                                              \n
                                                                                            1. Match the positive and negative electrode signs on the orange lid with the corresponding positive and negative signs on the blue base.<\/span><\/li>\n<\/ol>\n<\/li>\n
                                                                                            2. The orange lid should sit flush with the blue base using little force.<\/span><\/li>\n
                                                                                            3. Press the \u201cRun\u201d button<\/span>\n
                                                                                                \n
                                                                                              1. Check that the green light beside the power button remains illuminated.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n
                                                                                                  \n
                                                                                                1. Conduct electrophoresis for 20-25 minutes<\/span>\n
                                                                                                    \n
                                                                                                  1. The colored dye should progress to about half the length of the gel.<\/span><\/li>\n<\/ol>\n<\/li>\n
                                                                                                  2. Longer electrophoresis times will result in better size resolution.<\/span><\/li>\n
                                                                                                  3. Press the \u201clight bulb\u201d button to turn on the blueGel transilluminator.<\/span>\n
                                                                                                      \n
                                                                                                    1. For best viewing, place the viewing chamber over the blueGel machine.<\/span><\/li>\n<\/ol>\n<\/li>\n
                                                                                                    2. Gels may be viewed at the end of the run or periodically throughout the run.<\/span><\/li>\n
                                                                                                    3. Ensure that the bands in your gel have separated enough to clearly interpret your results<\/span>\n
                                                                                                        \n
                                                                                                      1. Run the gel longer if needed to increase resolution.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n
                                                                                                          \n
                                                                                                        1. Take a picture and insert it in the correct post-lab question.<\/span><\/li>\n<\/ol>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Bug.jpeg,https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Fly.jpeg,",,,10/06/2025,"

                                                                                                          Fly- Black with wings<\/p>\n

                                                                                                          Nat- Small bug with wings and white<\/p>\n",,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Gel.jpeg,","",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Image_20251212_095207_363-scaled.jpeg,",,,10/06/2025,"

                                                                                                          Very small insect with wings, 4 limbs, tan\/orange body, dark face.<\/p>\n",Diptera,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,SeaGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-05-at-10.16.51-AM.png,","

                                                                                                          Place the gel tray containing your gel in the buffer chamber
                                                                                                          \nEnsure that the clear buffer chamber is inside the blueGel electrophoresis system.<\/p>\n

                                                                                                          The wells of the gel should be on the same side as the negative electrode, away from the power button.<\/p>\n

                                                                                                          Use a graduated cylinder to add 30 ml of 1X TBE electrophoresis buffer
                                                                                                          \nThe buffer should just cover the gel and wells.<\/p>\n

                                                                                                          Ensure that there are no air bubbles in the wells (shake the gel gently if bubbles need to be dislodged).<\/p>\n

                                                                                                          Starting with the ladder in lane 1, gently hover your pipette tip over the well, and load 5 uL. Follow the loading key in the table below to load the rest of your gel. Remember to change tips between each sample.<\/p>\n",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/unnamed.jpg,",,,10/06/2026,"

                                                                                                          This Fly has a black body and thin, clear wings. Its eyes are a mix of colors.<\/p>\n",Diptera,DNeasy (Qiagen) blood and tissue kit,Abdomen,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/unnamed-2.jpg,","

                                                                                                            \n
                                                                                                          1. Place the gel tray containing your gel in the buffer chamber<\/span>\n
                                                                                                              \n
                                                                                                            1. Ensure that the clear buffer chamber is inside the blueGel electrophoresis system.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                               <\/p>\n

                                                                                                                \n
                                                                                                              1. The wells of the gel should be on the same side as the negative electrode, away from the power button.<\/span><\/li>\n<\/ol>\n

                                                                                                                 <\/p>\n

                                                                                                                  \n
                                                                                                                1. Use a graduated cylinder to add 30 ml of 1X TBE electrophoresis buffer<\/span>\n
                                                                                                                    \n
                                                                                                                  1. The buffer should just cover the gel and wells.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                     <\/p>\n

                                                                                                                      \n
                                                                                                                    1. Ensure that there are no air bubbles in the wells (shake the gel gently if bubbles need to be dislodged).<\/span><\/li>\n<\/ol>\n

                                                                                                                       <\/p>\n

                                                                                                                        \n
                                                                                                                      1. Starting with the ladder in lane 1, gently hover your pipette tip over the well, and load 5 uL. Follow the loading key in the table below to load the rest of your gel. Remember to change tips between each sample.\u00a0<\/span><\/li>\n<\/ol>\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n
                                                                                                                        Lane<\/b><\/td>\nSample<\/b><\/td>\n<\/tr>\n
                                                                                                                        1<\/span><\/td>\nDNA Ladder<\/span><\/td>\n<\/tr>\n
                                                                                                                        2<\/span><\/td>\nArthropod Sample #1<\/span><\/td>\n<\/tr>\n
                                                                                                                        3<\/span><\/td>\nArthropod Sample #2<\/span><\/td>\n<\/tr>\n
                                                                                                                        4<\/span><\/td>\nArthropod (+) Control (A #3)<\/span><\/td>\n<\/tr>\n
                                                                                                                        5<\/span><\/td>\nArthropod (-) Control (A #4)<\/span><\/td>\n<\/tr>\n
                                                                                                                        6<\/span><\/td>\n(+) DNA Control (A #5)<\/span><\/td>\n<\/tr>\n
                                                                                                                        7<\/span><\/td>\n(-) DNA Control (A #6)<\/span><\/td>\n<\/tr>\n
                                                                                                                        8<\/span><\/td>\nWolbachia Sample #1<\/span><\/td>\n<\/tr>\n
                                                                                                                        9<\/span><\/td>\nWolbachia Sample #2<\/span><\/td>\n<\/tr>\n
                                                                                                                        10<\/span><\/td>\nWolbachia (+) Control (W #3)<\/span><\/td>\n<\/tr>\n
                                                                                                                        11<\/span><\/td>\nWolbachia (-) Control (W #4)<\/span><\/td>\n<\/tr>\n
                                                                                                                        12<\/span><\/td>\n(+) DNA Control (W #5)<\/span><\/td>\n<\/tr>\n
                                                                                                                        13<\/span><\/td>\n(-) DNA Control (W #6)<\/span><\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                                                                                         <\/p>\n

                                                                                                                          \n
                                                                                                                        1. Place the orange cover on the blueGel electrophoresis system<\/span>\n
                                                                                                                            \n
                                                                                                                          1. Match the positive and negative electrode signs on the orange lid with the corresponding positive and negative signs on the blue base.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                             <\/p>\n

                                                                                                                              \n
                                                                                                                            1. The orange lid should sit flush with the blue base using little force.<\/span><\/li>\n<\/ol>\n

                                                                                                                               <\/p>\n

                                                                                                                                \n
                                                                                                                              1. Press the \u201cRun\u201d button<\/span>\n
                                                                                                                                  \n
                                                                                                                                1. Check that the green light beside the power button remains illuminated.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                                   <\/p>\n

                                                                                                                                    \n
                                                                                                                                  1. Conduct electrophoresis for 20-25 minutes<\/span>\n
                                                                                                                                      \n
                                                                                                                                    1. The colored dye should progress to about half the length of the gel.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                                       <\/p>\n

                                                                                                                                        \n
                                                                                                                                      1. Longer electrophoresis times will result in better size resolution.<\/span><\/li>\n<\/ol>\n

                                                                                                                                         <\/p>\n

                                                                                                                                          \n
                                                                                                                                        1. Press the \u201clight bulb\u201d button to turn on the blueGel transilluminator.<\/span>\n
                                                                                                                                            \n
                                                                                                                                          1. For best viewing, place the viewing chamber over the blueGel machine.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                                             <\/p>\n

                                                                                                                                              \n
                                                                                                                                            1. Gels may be viewed at the end of the run or periodically throughout the run.<\/span><\/li>\n<\/ol>\n

                                                                                                                                               <\/p>\n

                                                                                                                                                \n
                                                                                                                                              1. Ensure that the bands in your gel have separated enough to clearly interpret your results<\/span>\n
                                                                                                                                                  \n
                                                                                                                                                1. Run the gel longer if needed to increase resolution.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                                                   <\/p>\n

                                                                                                                                                    \n
                                                                                                                                                  1. Take a picture and insert it in the correct post-lab question.<\/span><\/li>\n<\/ol>\n",Yes,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Image_20251212_095205_886-scaled.jpeg,",,,10/06/2025,"

                                                                                                                                                    long, thin, beige<\/p>\n",Arthropoda,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-05-at-10.10.40-AM.png,","

                                                                                                                                                      \n
                                                                                                                                                    1. Place the gel tray containing your gel in the buffer chamber<\/span>\n
                                                                                                                                                        \n
                                                                                                                                                      1. Ensure that the clear buffer chamber is inside the blueGel electrophoresis system.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                                                         <\/p>\n

                                                                                                                                                          \n
                                                                                                                                                        1. The wells of the gel should be on the same side as the negative electrode, away from the power button.<\/span><\/li>\n<\/ol>\n

                                                                                                                                                           <\/p>\n

                                                                                                                                                            \n
                                                                                                                                                          1. Use a graduated cylinder to add 30 ml of 1X TBE electrophoresis buffer<\/span>\n
                                                                                                                                                              \n
                                                                                                                                                            1. The buffer should just cover the gel and wells.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                                                               <\/p>\n

                                                                                                                                                                \n
                                                                                                                                                              1. Ensure that there are no air bubbles in the wells (shake the gel gently if bubbles need to be dislodged).<\/span><\/li>\n<\/ol>\n

                                                                                                                                                                 <\/p>\n

                                                                                                                                                                  \n
                                                                                                                                                                1. Starting with the ladder in lane 1, gently hover your pipette tip over the well, and load 5 uL. Follow the loading key in the table below to load the rest of your gel. Remember to change tips between each sample.\u00a0<\/span><\/li>\n<\/ol>\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n
                                                                                                                                                                  Lane<\/b><\/td>\nSample<\/b><\/td>\n<\/tr>\n
                                                                                                                                                                  1<\/span><\/td>\nDNA Ladder<\/span><\/td>\n<\/tr>\n
                                                                                                                                                                  2<\/span><\/td>\nArthropod Sample #1<\/span><\/td>\n<\/tr>\n
                                                                                                                                                                  3<\/span><\/td>\nArthropod Sample #2<\/span><\/td>\n<\/tr>\n
                                                                                                                                                                  4<\/span><\/td>\nArthropod (+) Control (A #3)<\/span><\/td>\n<\/tr>\n
                                                                                                                                                                  5<\/span><\/td>\nArthropod (-) Control (A #4)<\/span><\/td>\n<\/tr>\n
                                                                                                                                                                  6<\/span><\/td>\n(+) DNA Control (A #5)<\/span><\/td>\n<\/tr>\n
                                                                                                                                                                  7<\/span><\/td>\n(-) DNA Control (A #6)<\/span><\/td>\n<\/tr>\n
                                                                                                                                                                  8<\/span><\/td>\nWolbachia Sample #1<\/span><\/td>\n<\/tr>\n
                                                                                                                                                                  9<\/span><\/td>\nWolbachia Sample #2<\/span><\/td>\n<\/tr>\n
                                                                                                                                                                  10<\/span><\/td>\nWolbachia (+) Control (W #3)<\/span><\/td>\n<\/tr>\n
                                                                                                                                                                  11<\/span><\/td>\nWolbachia (-) Control (W #4)<\/span><\/td>\n<\/tr>\n
                                                                                                                                                                  12<\/span><\/td>\n(+) DNA Control (W #5)<\/span><\/td>\n<\/tr>\n
                                                                                                                                                                  13<\/span><\/td>\n(-) DNA Control (W #6)<\/span><\/td>\n<\/tr>\n<\/tbody>\n<\/table>\n

                                                                                                                                                                   <\/p>\n

                                                                                                                                                                    \n
                                                                                                                                                                  1. Place the orange cover on the blueGel electrophoresis system<\/span>\n
                                                                                                                                                                      \n
                                                                                                                                                                    1. Match the positive and negative electrode signs on the orange lid with the corresponding positive and negative signs on the blue base.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                                                                       <\/p>\n

                                                                                                                                                                        \n
                                                                                                                                                                      1. The orange lid should sit flush with the blue base using little force.<\/span><\/li>\n<\/ol>\n

                                                                                                                                                                         <\/p>\n

                                                                                                                                                                          \n
                                                                                                                                                                        1. Press the \u201cRun\u201d button<\/span>\n
                                                                                                                                                                            \n
                                                                                                                                                                          1. Check that the green light beside the power button remains illuminated.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                                                                             <\/p>\n

                                                                                                                                                                              \n
                                                                                                                                                                            1. Conduct electrophoresis for 20-25 minutes<\/span>\n
                                                                                                                                                                                \n
                                                                                                                                                                              1. The colored dye should progress to about half the length of the gel.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                                                                                 <\/p>\n

                                                                                                                                                                                  \n
                                                                                                                                                                                1. Longer electrophoresis times will result in better size resolution.<\/span><\/li>\n<\/ol>\n

                                                                                                                                                                                   <\/p>\n

                                                                                                                                                                                    \n
                                                                                                                                                                                  1. Press the \u201clight bulb\u201d button to turn on the blueGel transilluminator.<\/span>\n
                                                                                                                                                                                      \n
                                                                                                                                                                                    1. For best viewing, place the viewing chamber over the blueGel machine.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                                                                                       <\/p>\n

                                                                                                                                                                                        \n
                                                                                                                                                                                      1. Gels may be viewed at the end of the run or periodically throughout the run.<\/span><\/li>\n<\/ol>\n

                                                                                                                                                                                         <\/p>\n

                                                                                                                                                                                          \n
                                                                                                                                                                                        1. Ensure that the bands in your gel have separated enough to clearly interpret your results<\/span>\n
                                                                                                                                                                                            \n
                                                                                                                                                                                          1. Run the gel longer if needed to increase resolution.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                                                                                             <\/p>\n

                                                                                                                                                                                              \n
                                                                                                                                                                                            1. Take a picture and insert it in the correct post-lab question.<\/span><\/li>\n<\/ol>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-05-at-10.01.44-AM.png,",,,10/06/2025,"

                                                                                                                                                                                              Tiny grey moth with small wings and a tiny thorax<\/p>\n",Lepidoptera,DNeasy (Qiagen) blood and tissue kit,Abdomen,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2025-12-19-at-9.50.28-AM.png,","

                                                                                                                                                                                              Place the gel tray containing your gel in the buffer chamber
                                                                                                                                                                                              \nEnsure that the clear buffer chamber is inside the blueGel electrophoresis system.<\/p>\n

                                                                                                                                                                                              The wells of the gel should be on the same side as the negative electrode, away from the power button.<\/p>\n

                                                                                                                                                                                              Use a graduated cylinder to add 30 ml of 1X TBE electrophoresis buffer
                                                                                                                                                                                              \nThe buffer should just cover the gel and wells.<\/p>\n

                                                                                                                                                                                              Ensure that there are no air bubbles in the wells (shake the gel gently if bubbles need to be dislodged).<\/p>\n

                                                                                                                                                                                              Starting with the ladder in lane 1, gently hover your pipette tip over the well, and load 5 uL. Follow the loading key in the table below to load the rest of your gel. Remember to change tips between each sample.<\/p>\n

                                                                                                                                                                                              Place the orange cover on the blueGel electrophoresis system
                                                                                                                                                                                              \nMatch the positive and negative electrode signs on the orange lid with the corresponding positive and negative signs on the blue base.<\/p>\n

                                                                                                                                                                                              The orange lid should sit flush with the blue base using little force.<\/p>\n

                                                                                                                                                                                              Press the \u201cRun\u201d button
                                                                                                                                                                                              \nCheck that the green light beside the power button remains illuminated.<\/p>\n

                                                                                                                                                                                              Conduct electrophoresis for 20-25 minutes
                                                                                                                                                                                              \nThe colored dye should progress to about half the length of the gel.<\/p>\n

                                                                                                                                                                                              Longer electrophoresis times will result in better size resolution.<\/p>\n

                                                                                                                                                                                              Press the \u201clight bulb\u201d button to turn on the blueGel transilluminator.
                                                                                                                                                                                              \nFor best viewing, place the viewing chamber over the blueGel machine.<\/p>\n

                                                                                                                                                                                              Gels may be viewed at the end of the run or periodically throughout the run.<\/p>\n

                                                                                                                                                                                              Ensure that the bands in your gel have separated enough to clearly interpret your results
                                                                                                                                                                                              \nRun the gel longer if needed to increase resolution.<\/p>\n

                                                                                                                                                                                              Take a picture and insert it in the correct post-lab question<\/p>\n",No,,,, "https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Image_20251212_095202_350-scaled.jpeg,",,,10/06/2025,"

                                                                                                                                                                                              long and thin, beige<\/p>\n",Arthropoda,DNeasy (Qiagen) blood and tissue kit,Whole arthropod,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2026/01/Screenshot-2026-01-05-at-10.10.40-AM.png,","

                                                                                                                                                                                                \n
                                                                                                                                                                                              1. Place the gel tray containing your gel in the buffer chamber<\/span>\n
                                                                                                                                                                                                  \n
                                                                                                                                                                                                1. Ensure that the clear buffer chamber is inside the blueGel electrophoresis system.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                                                                                                   <\/p>\n

                                                                                                                                                                                                    \n
                                                                                                                                                                                                  1. The wells of the gel should be on the same side as the negative electrode, away from the power button.<\/span><\/li>\n<\/ol>\n

                                                                                                                                                                                                     <\/p>\n

                                                                                                                                                                                                      \n
                                                                                                                                                                                                    1. Use a graduated cylinder to add 30 ml of 1X TBE electrophoresis buffer<\/span>\n
                                                                                                                                                                                                        \n
                                                                                                                                                                                                      1. The buffer should just cover the gel and wells.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                                                                                                         <\/p>\n

                                                                                                                                                                                                          \n
                                                                                                                                                                                                        1. Ensure that there are no air bubbles in the wells (shake the gel gently if bubbles need to be dislodged).<\/span><\/li>\n<\/ol>\n

                                                                                                                                                                                                           <\/p>\n

                                                                                                                                                                                                            \n
                                                                                                                                                                                                          1. Starting with the ladder in lane 1, gently hover your pipette tip over the well, and load 5 uL<\/span><\/span>\n
                                                                                                                                                                                                              \n
                                                                                                                                                                                                            1. Place the orange cover on the blueGel electrophoresis system<\/span>\n
                                                                                                                                                                                                                \n
                                                                                                                                                                                                              1. Match the positive and negative electrode signs on the orange lid with the corresponding positive and negative signs on the blue base.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                                                                                                                \u00a0<\/span><\/span><\/p>\n

                                                                                                                                                                                                                  \n
                                                                                                                                                                                                                1. The orange lid should sit flush with the blue base using little force.<\/span><\/li>\n<\/ol>\n

                                                                                                                                                                                                                  \u00a0<\/span><\/span><\/p>\n

                                                                                                                                                                                                                    \n
                                                                                                                                                                                                                  1. Press the \u201cRun\u201d button<\/span>\n
                                                                                                                                                                                                                      \n
                                                                                                                                                                                                                    1. Check that the green light beside the power button remains illuminated.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                                                                                                                      \u00a0<\/span><\/span><\/p>\n

                                                                                                                                                                                                                        \n
                                                                                                                                                                                                                      1. Conduct electrophoresis for 20-25 minutes<\/span>\n
                                                                                                                                                                                                                          \n
                                                                                                                                                                                                                        1. The colored dye should progress to about half the length of the gel.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                                                                                                                          \u00a0<\/span><\/span><\/p>\n

                                                                                                                                                                                                                            \n
                                                                                                                                                                                                                          1. Longer electrophoresis times will result in better size resolution.<\/span><\/li>\n<\/ol>\n

                                                                                                                                                                                                                            \u00a0<\/span><\/span><\/p>\n

                                                                                                                                                                                                                              \n
                                                                                                                                                                                                                            1. Press the \u201clight bulb\u201d button to turn on the blueGel transilluminator.<\/span>\n
                                                                                                                                                                                                                                \n
                                                                                                                                                                                                                              1. For best viewing, place the viewing chamber over the blueGel machine.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                                                                                                                                \u00a0<\/span><\/span><\/p>\n

                                                                                                                                                                                                                                  \n
                                                                                                                                                                                                                                1. Gels may be viewed at the end of the run or periodically throughout the run.<\/span><\/li>\n<\/ol>\n

                                                                                                                                                                                                                                  \u00a0<\/span><\/span><\/p>\n

                                                                                                                                                                                                                                    \n
                                                                                                                                                                                                                                  1. Ensure that the bands in your gel have separated enough to clearly interpret your results<\/span>\n
                                                                                                                                                                                                                                      \n
                                                                                                                                                                                                                                    1. Run the gel longer if needed to increase resolution.<\/span><\/li>\n<\/ol>\n<\/li>\n<\/ol>\n

                                                                                                                                                                                                                                      \u00a0<\/span><\/span><\/li>\n<\/ol>\n",No,,,, "",,,09/17/2025,"

                                                                                                                                                                                                                                      The ant was darck brown and black was bigger than a rain of rice.<\/p>\n",Formica glacialis,DNeasy (Qiagen) blood and tissue kit,Abdomen,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2025/12/Screenshot-2025-12-09-082839.png,","

                                                                                                                                                                                                                                      I was in the 2nd and 3rd lanes.<\/p>\n",No,,,, "",44.9262766138,-93.1739343346,09/07/2025,"",Formica glacialis,DNeasy (Qiagen) blood and tissue kit,Abdomen,MiniPCR,TBE,SeeGreen,"https://wolbachiaprojectdb.org/wp-content/uploads/2025/12/unnamed-1-3.jpg,","

                                                                                                                                                                                                                                      Arthropod DNA lane 8, Wolbachia Lane 9<\/p>\n",Yes,,,, "",44.9264534655,-93.1723063252,09/07/2025,"

                                                                                                                                                                                                                                      The spider was collected from a web in a pile of yard waste in a field.<\/p>\n",Neoscona crucifera,DNeasy (Qiagen) blood and tissue kit,Partial abdomen,MiniPCR,TBE,SeeGreen,"","