Sample information
Picture	Photos by: Anja Zingerle
Location
Collection date	08/28/2024
Captive / Cultivated?	Wild-caught
Group	KantiWil
Observations	auf grünen Blättern von Laubbaum, ca.1m Höhe
Putative identification	Arthropoda Hexapoda Insecta Hemiptera Pentatomidae Palomena Palomena prasina
Methods
Extraction kit	Instagene Matrix
DNA extraction location
Single or Duplex PCR	Duplex Reaction
Gel electrophoresis system	Standard electrophoresis system
Buffer	TAE
DNA stain	SYBR Safe
Gel images
Protocol notes
Results
Wolbachia presence	Yes
Confidence level	Medium
Explanation of confidence level
Wolbachia 16S sequence	Download FASTA    Download AB1 ATTGGAGGATTTGGAAATTGATTAA BLAST at The Wolbachia Project   BLAST at NCBI
Arthropod COI sequence
Summary	The Palomena prasina was found to be postive for Wolbachia.