American Carpenter Ant

November 15, 2024

Sample information
Picture
Photos by: Annika G.
Location
Collection date 11/12/2024
Captive / Cultivated? Wild-caught
Group Walton High School
Observations

Environment was a forested area. Found near medium-sized rocks and on moist area under leaves and branches. No other ants were apparent or seen near the ant.
Putative identification Arthropoda

Methods
Extraction kit DNeasy (Qiagen)
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniPCR
Buffer TBE
DNA stain GelGreen
Gel images
Protocol notes

Gel results for determining presence of Wolbachia in this specimen were not conclusive. Unclear bands may have been due to error during PCR, specifically with the centrifuging timeline during the process. Clear bands were present for the CO1 gel, and results were sent for specimen identification.

Results
Wolbachia presence Unknown
Confidence level High
Explanation of confidence level

Wolbachia gel electrophoresis results were not clear, with bands being blurry and indistinct. The PCR Positive control was faint while the positive Drosophila control was nonexistent. Unclear results from the controls, likely due to poor DNA extraction, prevent accurate Wolbachia determination.
Wolbachia 16S sequence
Arthropod COI sequence
TTGTTTTTTCGTTGCATTTGATCANGAATAATTGGTTCTTCAATAAGAATAATTATTCGATTAGAATTAGGATCCCCTGATTCACTAATTCTTAATGATCAAACCTTTAATACTATTGTTACAAGCCATGCTTTTATTATAATCTTTTTTATAGTTATACCTTTTATAATTGGGGGATTTGGTAACTTCTTAGTACCCTTAATACTTGGATCTCCCGATATAGCCTACCCACGCATAAATAACATAAGATTTTGATTGCTACCCCCTTCAATCTCTCTATTAATCTTAAGAAACTTTATTAATGAAGGATCAGGTACAGGTTGAACTATTTACCCCCCTCTATCGTCTAATACCTTTCATAGTGGTCCCTCTATTGATTTAACTATTTTTTCCCTTCATATTGCCGGAATATCATCAATTCTAGGAGCAATCAATTTTATTTCAACAATTTTAAATATACATAATTCTAATATTTCTTTAGATAAAATTCCTCTATTAGTATGATCTATTCTTATCACTGCTATTCTCCTTCTCCTCTCCCTTCCTGTTCTTGCAGGAGCTATTACAATACTACTTACAGACCGAAATCTCAATACTTCATTCTTTGATCCCTCGGGAGGAGGAGACCCTATTCTATACCAACACTTATTTTGATTTTTTGGTCACCTTGAAAGTTAAA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary
Report Inappropriate Post