Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 08/28/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | KantiWil |
| Observations | auf grünen Blättern von Laubbaum, ca.1m Höhe |
| Putative identification | Arthropoda Insecta Hemiptera Pentatomidae Palomena Palomena prasina |
Methods |
|
| Extraction kit | Instagene Matrix |
| DNA extraction location | |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | Yes |
| Confidence level | Medium |
| Explanation of confidence level | |
| Wolbachia 16S sequence | Download FASTA
Download AB1
ATTGGAGGATTTGGAAATTGATTAA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence |
|
| Summary | The Palomena prasina was found to be postive for Wolbachia. |


Umbrella Wasp
Fannia Canicularis
Oulema Obsucra JM2
Collembola
Linyphiidae BK1