Sample information |
|
Picture |
![]() |
---|---|
Location | |
Collection date | 08/28/2024 |
Captive / Cultivated? | Wild-caught |
Group | KantiWil |
Observations | auf grünen Blättern von Laubbaum, ca.1m Höhe |
Putative identification | Arthropoda Hexapoda Insecta Hemiptera Pentatomidae Palomena Palomena prasina |
Methods |
|
Extraction kit | Instagene Matrix |
DNA extraction location | |
Single or Duplex PCR | Duplex Reaction |
Gel electrophoresis system | Standard electrophoresis system |
Buffer | TAE |
DNA stain | SYBR Safe |
Gel images |
![]() |
Protocol notes | |
Results |
|
Wolbachia presence | Yes |
Confidence level | Medium |
Explanation of confidence level | |
Wolbachia 16S sequence | Download FASTA
Download AB1
ATTGGAGGATTTGGAAATTGATTAA
BLAST at The Wolbachia Project BLAST at NCBI
|
Arthropod COI sequence |
|
Summary | The Palomena prasina was found to be postive for Wolbachia. |