Sample information |
|
Picture |
|
---|---|
Location | |
Collection date | 09/04/2024 |
Captive / Cultivated? | Wild-caught |
Group | Benedictine University |
Observations | Collected by Fall 2024 Students BenU |
Putative identification | Arthropoda Hexapoda Insecta Hymenoptera |
Methods |
|
Extraction kit | DNeasy (Qiagen) blood and tissue kit |
DNA extraction location | Partial abdomen |
Single or Duplex PCR | Single Reaction |
Gel electrophoresis system | Standard electrophoresis system |
Buffer | TAE |
DNA stain | SYBR Safe |
Gel images |
|
Protocol notes | |
Results |
|
Wolbachia presence | No |
Confidence level | High |
Explanation of confidence level | When we had a control for negative Wolbachia on our gel, My insect well #5 is aligned with the control. Therefore, I know that my insect is negative for Wolbachia |
Wolbachia 16S sequence | |
Arthropod COI sequence | Download FASTA
AGTTGAAATAAAATTAATAGCTCCTAAAATTGAAGATATACCCGCAATATGGAGGGAAAAAATAGTTAAATCAACTGAAG GTCCATTATGGAAAATATTTGAAGCTAAAGGAGGATAAACAGTTCATCCTGTCCCAACACCATCATTAATAAAATTTCTT AAAATAAGAAGAGAAATTGAGGGGGGTAAAAGTCAAAATCTCATATTGTTTATACGTGGATAAGCTATATCAGGTGAGCC TAATATTAAAGGTACAAGGAAATTT
BLAST at The Wolbachia Project BLAST at NCBI
|
Summary | The Hymenoptera was found to be negative for Wolbachia. |