Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/04/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | Benedictine University |
| Observations | Collected by Fall 2024 Students BenU |
| Putative identification | Arthropoda Insecta Hymenoptera |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Partial abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | When we had a control for negative Wolbachia on our gel, My insect well #5 is aligned with the control. Therefore, I know that my insect is negative for Wolbachia |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
AGTTGAAATAAAATTAATAGCTCCTAAAATTGAAGATATACCCGCAATATGGAGGGAAAAAATAGTTAAATCAACTGAAG GTCCATTATGGAAAATATTTGAAGCTAAAGGAGGATAAACAGTTCATCCTGTCCCAACACCATCATTAATAAAATTTCTT AAAATAAGAAGAGAAATTGAGGGGGGTAAAAGTCAAAATCTCATATTGTTTATACGTGGATAAGCTATATCAGGTGAGCC TAATATTAAAGGTACAAGGAAATTT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Hymenoptera was found to be negative for Wolbachia. |


Blattodea LB2
tenebrio molitor_To1
JC2
YSD2