Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/03/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | Benedictine University |
| Observations | Collected by Fall 2024 students |
| Putative identification | Arthropoda Hexapoda Insecta Hemiptera Cicadidae Magicicada Magicicada septendecim |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Partial abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | Yes |
| Confidence level | Low |
| Explanation of confidence level | Mildly thick band. 99% match on BLAST. |
| Wolbachia 16S sequence |
AAGACATCTCAGTTCGGATTGTACTCTGCAACTCGAGTGCATGAAGT TGGAATCGCTAGTAATCGTGGATCA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence |
|
| Summary | The Magicicada septendecim was found to be postive for Wolbachia. |
Water Boatman