Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 02/19/2025 |
| Captive / Cultivated? | Captive / Cultivated |
| Group | Berkshire Community College |
| Observations | Tan colored insect that is approximately 1 inch in length. It has antenna, legs and they hold their wings flat over their backs since they no longer fly. These are typically sold in local pet stores to feed pets like lizards. I purchased this cricket at PetCo in Pittsfield, MA. |
| Putative identification | Arthropoda Insecta Orthoptera Gryllidae Acheta Acheta domesticus |
Methods |
|
| Extraction kit | Monarch DNA extraction (NEB) |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Edvotek Gel Electrophoresis |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | Taq Polymerase (New England Biolabs One Taq Hot Start) used, Start Quick-Load 2x MM w/ Standard Buffer (product #M0488S. DNA Ladder Used: New England Biolabs 1kb Plus DNA Ladder for Safe Stains (product #N0559S) Annealing temperatures 1 cycle 30 sec @ 94 C, 30 cycles 30 sec @ 94 C and 45 sec @ 49 C and 60 Sec @ 68 C, 1 cycle 5 min @ 68 C. Arthropod PCR reaction completed on 3/13/25, annealing temperature 49C. Wolbachia (single) PCR reaction completed on 4/3/25, annealing temperature 55C. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | The arthropod sample had a lot of DNA in it which caused a smear, however I am still highly confident that the results are accurate, that there is no Wolbachia in the common house cricket collected. We had good controls for the remainder of the lanes in both gels. We had a good DNA ladder, good arthropod positive and negative lanes even though there was a faint band in the Wolbachia gel. There was a bright band for the positive DNA band. There was nothing in the water lane. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download AB1
CTCTTTAAGTATCTTAATTCGAACGGAACTAGGACAACCAGGTTATTTAATTGGAGATGATCAAACATATAATGTTATCG TAACTGCACATGCATTTGTCATAATTTTTTTCATGGTTATACCAATTATAATTGGTGGATTCGGAAATTGATTAGTACCC CTAATATTAGGTGCACCCGATATAGCCTTTCCTCGAATAAACAATATAAGATTTTGACTTTTACCACCCTCACTAACCCT TTTATTAACCAGAAGAATAGTCGAAAATGGTGCAGGGACAGGATGAACAGTTTATCCACCTTTATCAACAGGAATCGCCC ACGCCGGAGCATCTGTTGATTTAGCCATTTTTTCATTACACTTAGCTGGAATTTCATCAATTCTGGGAGCCGTTAATTTC ATTACAACTATAATCAATATACGAGCACCTGGGATGTCATTAGATCAAACCCCATTATTTGTATGAGCTGTTGGAATCAC TGCCCTCCTCCTATTATTATCTTTACCTGTTCTTGCGGGTGCAATCACAATATTACTAACAGATCGAAATCTGAATACAT CATT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Acheta domesticus was found to be negative for Wolbachia. |





Ant like creature – Draft
Myrmaplata plantaleoides (Unsure) – Draft
leaf hopper nymph
Pheidole species (Minor Worker)
JTR 1