Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 03/31/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Scientists in Residence |
| Observations | This bug was found on a curtain for a glass door near the kitchen. It had been sunny outside and the bug was taken in the evening. The bug was alone and had been flying around the chandelier that was turned on. |
| Putative identification | Arthropoda Insecta Hemiptera Pentatomidae Halyomorpha Halyomorpha halys |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniOne |
| Buffer | TBE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | My arthropod was in well two in Gel 1. All of Gel 2 contained positive controls besides well seven. In Gel 1, wells one, four, and six were also positive while the others were negative. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | All of the controls worked as they were supposed to. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
TNCAGCTATAAGATTAATTATCCGTATCGAATTAGGACAGCCTGGAAGATTTATTGGTAATGATCAAATTTATAATGTAA TTGTAACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATAATTGGAGGATTCGGTAATTGATTAGTC CCTTTAATAATTGGAGCACCTGATATAGCCTTCCCACGATTAAATAATATAAGATTCTGATTATTACCCCCTTCATTAAC TTTATTATTAATAAGAAGAATAGCAGAATCAGGAGCTGGGACAGGATGAACAGTCTATCCCCCCTTATCAAGTAATATCT CACATAGAGGAGCATCAGTTGATTTAGCTATTTTTTCCTTACATTTGGCTGGGGTTTCATCAATTTTAGGGGCAGTAAAT TTTATTTCAACTATTATAAATATACGACCAACAGGTATAACCCCTGAACGAATCCCATTGTTTGTGTGATCAGTAGGAAT TACTGCACTTCTTCTGTTATTATCCTTACCTGTGTTAGCAGGTGCTATTACTATACTATTAACTGACCGAAATTTTAATA CCTCTTTTTTTGACCCATCAGGAGGA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Halyomorpha halys was found to be negative for Wolbachia. |



Formica Pallidefulva
Formica Pallidefulva
Ant
Differential Grasshopper – Melanoplus differentialis
Pill Bug (Armadillidium vulgare) – Draft