Wolbachia-negative (Pollenia pediculata/species in infraorder Astacidea)

Sample information

Picture
Entry by: Zachary L.
Location
Collection date 04/01/2025
Captive / Cultivated? Wild-caught
Group College of Eastern Idaho
Observations

Subject was caught alive in a freshwater aquatic (pond) environment.

Putative identification Arthropoda Insecta Diptera Polleniidae Pollenia Pollenia pediculata

Methods

Extraction kit Edwards Buffer
DNA extraction location Partial abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain GelGreen
Gel images
Protocol notes

The sample gel electrophoresis tests are located in the bottom gel, rightmost column, fourth and eighth rows (WspecF and CO1, respectively) (see gel EP image). The shakiness of the bars in the Gel EP suggests imperfections in the gel structure, most likely during formation.

The DNA extraction was performed on the reproductive organs of the sample (female).

Results

Wolbachia presence No
Confidence level Low
Explanation of confidence level

There is apparent, extreme contamination, given that the collected sample is most likely in the subphylum Crustacea (rather than Hexapoda) according to the observational evidence present (see arthropod image). Furthermore, the ab1 file shows extreme contamination to the point of being highly unreliable (see above). As such, I can’t be certain that my test forĀ Wolbachia was successful or not.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
CCCTGGAGCATTAATCGGTGATGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTTGTTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGACTTGGAAATTGACTTGTTCCTTTAATATTAGGAGCACCTGATATAGCATTCCCTCAAATGAATAATATAATTTTTTGACTCTTACCTCCTGCNCTNACTTTATTATTGGTGAGCAGTATAGTGGAAAACGGAGCTGGGACAGGATGAACTGTTTACCCACCTCTATCTTCTAATATTGCTCATGGAGGGGCTTCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCAAGAATNTCTTCTCTTTTAGGAGCAGTTAATTTTATTACNACTGTATTTAATATACNATCTACAGGTATTACATTTGACCGCNTACCTTTATTTGTTTTATCTGTANTAATTACNGCCTTATTAATTTTT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Pollenia pediculata was found to be negative for Wolbachia.
Report Inappropriate Post