Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 04/01/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | College of Eastern Idaho |
| Observations | Subject was caught alive in a freshwater aquatic (pond) environment. |
| Putative identification | Arthropoda Insecta Diptera Polleniidae Pollenia Pollenia pediculata |
Methods |
|
| Extraction kit | Edwards Buffer |
| DNA extraction location | Partial abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | The sample gel electrophoresis tests are located in the bottom gel, rightmost column, fourth and eighth rows (WspecF and CO1, respectively) (see gel EP image). The shakiness of the bars in the Gel EP suggests imperfections in the gel structure, most likely during formation. The DNA extraction was performed on the reproductive organs of the sample (female). |
Results |
|
| Wolbachia presence | No |
| Confidence level | Low |
| Explanation of confidence level | There is apparent, extreme contamination, given that the collected sample is most likely in the subphylum Crustacea (rather than Hexapoda) according to the observational evidence present (see arthropod image). Furthermore, the ab1 file shows extreme contamination to the point of being highly unreliable (see above). As such, I can’t be certain that my test forĀ Wolbachia was successful or not. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
CCCTGGAGCATTAATCGGTGATGATCAAATTTATAATGTAATTGTAACAGCCCATGCCTTTGTTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGACTTGGAAATTGACTTGTTCCTTTAATATTAGGAGCACCTGATATAGCATTCCCTCAAATGAATAATATAATTTTTTGACTCTTACCTCCTGCNCTNACTTTATTATTGGTGAGCAGTATAGTGGAAAACGGAGCTGGGACAGGATGAACTGTTTACCCACCTCTATCTTCTAATATTGCTCATGGAGGGGCTTCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCAAGAATNTCTTCTCTTTTAGGAGCAGTTAATTTTATTACNACTGTATTTAATATACNATCTACAGGTATTACATTTGACCGCNTACCTTTATTTGTTTTATCTGTANTAATTACNGCCTTATTAATTTTT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Pollenia pediculata was found to be negative for Wolbachia. |


Blattodea LB2
tenebrio molitor_To1
JC2
YSD2