Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 05/04/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | California Academy of Mathematics and Science |
| Observations | Sand crab was collected along the Redondo Beach shoreline inside the sand when waves came up (early afternoon). Weather was overcast and around 65 degrees F. No environmental image was taken. |
| Putative identification | Arthropoda Malacostraca Decapoda |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | MiniOne |
| Buffer | 1X TAE |
| DNA stain | UView |
| Gel images |
|
| Protocol notes | DNA Ladder in well 1 Controls run from wells 10-13 (Arthropod +, Arthropod -, DNA +, and DNA – respectively) 6X UView stain used for all samples, controls, and ladder. 1X TAE Buffer used in the gel casting and electrophoresis chamber. |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | The bands aren’t completely clear, but the controls offer accurate results on which genes should or should not be present. There is definitely no Wolbachia band in well 3, 4, and 6. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
NNNNNNNNNNNNNNNCNNAGNNNNNNCTGGGATAGTGGGCACTTCCTTAAGACTTATTATTCGAGCAGAGTTAGGCAAAC CAGGAAGACTAATTGGGGACGACAAGATTTATAATGTCATTGTCACTGCCCACGCGTTTGTTATAATTTTCTTTATAGTT ATACCGATCATAATCGGGGGATTTGGTAATTGGCTAGTACATCTTATATTAGGTGCCCCAGACATAGCTTTTCCACGTAT AAACAATATAAGATTCTGACTTTTGCCCCCTTCCCTAACACTTCTTCTCATGAGTGGAATANTGGAAAGAGGAGTTGGTA CGGGATGGACAGTTTATCCTCCCANATCATCANCTCTCGCCTATTGGANGGCTTGCCNAGCCCTTGGTATTTATTGATTT CNNTCCCTAANNNNAGCATCATTATNGGANNNGGGANTTTTATTTNACTNACATTTTTATTTATTANATGTATTNCC
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Decapoda was found to be negative for Wolbachia. |


Blattodea LB2
tenebrio molitor_To1
JC2
YSD2