Emerita analoga (B, 2) GRP 3

Sample information

Picture
Entry by: Sydney P.
Location
Collection date 05/04/2025
Captive / Cultivated? Wild-caught
Group California Academy of Mathematics and Science
Observations

Sand crab was collected along the Redondo Beach shoreline inside the sand when waves came up (early afternoon). Weather was overcast and around 65 degrees F. No environmental image was taken.

Putative identification Arthropoda Malacostraca Decapoda

Methods

Extraction kit DNeasy (Qiagen)
DNA extraction location Abdomen
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system MiniOne
Buffer 1X TAE
DNA stain UView
Gel images
Protocol notes

DNA Ladder in well 1
Emerita analoga sample 1 (A) in well 3, sample 2 (B) in well 4, and sample 3 (D) in well 6

Controls run from wells 10-13 (Arthropod +, Arthropod -, DNA +, and DNA – respectively)

6X UView stain used for all samples, controls, and ladder. 1X TAE Buffer used in the gel casting and electrophoresis chamber.

Results

Wolbachia presence No
Confidence level Medium
Explanation of confidence level

The bands aren’t completely clear, but the controls offer accurate results on which genes should or should not be present. There is definitely no Wolbachia band in well 3, 4, and 6.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
NNNNNNNNNNNNNNNCNNAGNNNNNNCTGGGATAGTGGGCACTTCCTTAAGACTTATTATTCGAGCAGAGTTAGGCAAAC CAGGAAGACTAATTGGGGACGACAAGATTTATAATGTCATTGTCACTGCCCACGCGTTTGTTATAATTTTCTTTATAGTT ATACCGATCATAATCGGGGGATTTGGTAATTGGCTAGTACATCTTATATTAGGTGCCCCAGACATAGCTTTTCCACGTAT AAACAATATAAGATTCTGACTTTTGCCCCCTTCCCTAACACTTCTTCTCATGAGTGGAATANTGGAAAGAGGAGTTGGTA CGGGATGGACAGTTTATCCTCCCANATCATCANCTCTCGCCTATTGGANGGCTTGCCNAGCCCTTGGTATTTATTGATTT CNNTCCCTAANNNNAGCATCATTATNGGANNNGGGANTTTTATTTNACTNACATTTTTATTTATTANATGTATTNCC
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Decapoda was found to be negative for Wolbachia.
Report Inappropriate Post