Cellar Spider GROUP 4

May 22, 2025

Sample information
Picture
Photos by: Gabe M.
Location
Collection date 04/30/2025
Captive / Cultivated? Wild-caught
Group California Academy of Mathematics and Science
Observations

Spider was collected at California Academy of Mathematics and Science. Weather between 55-65 Fahrenheit.
Putative identification Arthropoda Arachnida

Methods
Extraction kit DNeasy (Qiagen)
DNA extraction location Abdomen
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system MiniOne
Buffer 1X TAE
DNA stain UView
Gel images
Protocol notes

lane 2: mm ruler

lane 3: uni. ruler

lane 5: long leg spider

lane 6: roly poly

lane 7: dragon fly

lane 8: black aphids

lane 9: (+) arthro control

lane 10: (-) arthro control

lane 11: (+) DNA control

lane 12: water

lane 14: mm ruler

lane 15: uni. ruler

Results
Wolbachia presence Yes
Confidence level Low
Explanation of confidence level

The gel show vague bands in lane 4 (cellar spider). There’s a QS value of 55, passing the quality control level. However, CRL is less than 500 (384) so it doesn’t pass the QS. Because our CRL is less than 500, our results show problems with the results and we would need to examine the data for more information.
Wolbachia 16S sequence
>43_LongLegSpider-WSpecF_A08.ab1 NNNNNNNNNNNNNNNGGTGTTGCATGGCTGTCGTCAGCTCGTATCGTGAGATGTTGGGTTAAGTCCCGCAACGAGCGCAA CCCTCATCCTTAGTTACCATCAGGTAATGCTGGGGACTTTAAGGAAACTGCCAGTGATAAACTGGAGGAAGGTGGGGATG ATGTCAAGTCATCATGGCCCTTATGGAGTGGGCTACACACGTGCTACAATGGTGGCTACAATGGGCTGCAAAGTCGCGAG GCTAAGCTAATCCCTTAAAAGCCATCTCAGTTCGGATTGTACTCTGCAACTCGAGTGCATGAAGTTGGAATCGCTAGTAA TCGTGGATCAGCACGCCACGGTGAATACGTTCTCGGGTCTTGTACACACTGCCCGTCACGCCATGGGAATTGGTTNNNNN CGAAGNNNN
BLAST at The Wolbachia Project   BLAST at NCBI
Arthropod COI sequence
Summary The Arachnida was found to be postive for Wolbachia.
Report Inappropriate Post