Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 04/30/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | California Academy of Mathematics and Science |
| Observations | Spider was collected at California Academy of Mathematics and Science. Weather between 55-65 Fahrenheit. |
| Putative identification | Arthropoda Arachnida |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | MiniOne |
| Buffer | 1X TAE |
| DNA stain | UView |
| Gel images |
|
| Protocol notes | lane 2: mm ruler lane 3: uni. ruler lane 5: long leg spider lane 6: roly poly lane 7: dragon fly lane 8: black aphids lane 9: (+) arthro control lane 10: (-) arthro control lane 11: (+) DNA control lane 12: water lane 14: mm ruler lane 15: uni. ruler |
Results |
|
| Wolbachia presence | Yes |
| Confidence level | Low |
| Explanation of confidence level | The gel show vague bands in lane 4 (cellar spider). There’s a QS value of 55, passing the quality control level. However, CRL is less than 500 (384) so it doesn’t pass the QS. Because our CRL is less than 500, our results show problems with the results and we would need to examine the data for more information. |
| Wolbachia 16S sequence |
>43_LongLegSpider-WSpecF_A08.ab1 NNNNNNNNNNNNNNNGGTGTTGCATGGCTGTCGTCAGCTCGTATCGTGAGATGTTGGGTTAAGTCCCGCAACGAGCGCAA CCCTCATCCTTAGTTACCATCAGGTAATGCTGGGGACTTTAAGGAAACTGCCAGTGATAAACTGGAGGAAGGTGGGGATG ATGTCAAGTCATCATGGCCCTTATGGAGTGGGCTACACACGTGCTACAATGGTGGCTACAATGGGCTGCAAAGTCGCGAG GCTAAGCTAATCCCTTAAAAGCCATCTCAGTTCGGATTGTACTCTGCAACTCGAGTGCATGAAGTTGGAATCGCTAGTAA TCGTGGATCAGCACGCCACGGTGAATACGTTCTCGGGTCTTGTACACACTGCCCGTCACGCCATGGGAATTGGTTNNNNN CGAAGNNNN
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence |
|
| Summary | The Arachnida was found to be postive for Wolbachia. |


Blattodea LB2
tenebrio molitor_To1
JC2
YSD2