Camponotus chromaiodes

June 5, 2025

Sample information
Picture
Photos by: Fiona R.
Location
Collection date 06/03/2025
Captive / Cultivated? Wild-caught
Group Pingry School
Observations

A black insect with a brown thorax. It has six legs, mandibles, and antennas
Putative identification Arthropoda Hexapoda Insecta Hymenoptera Formicidae Camponotus

Methods
Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes

DNA was extracted using the DNeasy extraction kit. Then, PCR was performed to amplify DNA in order to test for Wolbachia and arthropod DNA in gel electrophoresis. We used 2% gel using 1X TAE buffer and agarose. In the gel, the top wells were used to test for arthropod DNA while the bottom wells were used to test for the presence or absence of Wolbachia. 10 microliters of sample and 4 microliters of dye were loaded into the gel. The first wells on both the top and bottom were the ladder, then the bug sample, positive and negative arthropod controls, and a negative DNA control.

Results
Wolbachia presence Yes
Confidence level High
Explanation of confidence level

Results support insect is both an arthropod and is infected with Wolbachia. The second column on the top row shows insect is an arthropod—it contains the arthropod gene. The second column on the bottom row shows insect is infected with Wolbachia. Arthropod band is approximately 5kb long, Wolbachia band is approximately 2.5kb long
Wolbachia 16S sequence Download FASTA    Download AB1
GTTGGGTTAAGTCCCGCAACGAGCGCAACCCTCATCCTTAGTTACCATCAGGTAATGCTGGGGACTTTAAGGAAACTGCCAGTGATAAACTGGAGGAAGGTGGGGATGATGTCAAGTCATCATGGCCCTTATGGAGTGGGCTACACACGTGCTACAATGGTGGCTACAATGGGCTGCAAAGTCGCGAGGCTAAGCTAATCCCTTAAAAGCCATCTCAGTTCGGATTGTACTCTGCAACTCGAGTGCATGAAGTTGGAATCGCTAGTAATCGTGGATCAGCACGCCAC
BLAST at The Wolbachia Project   BLAST at NCBI
Arthropod COI sequence Download FASTA    Download AB1
TTTATTAATGAAGGATCTGGAACTGGTTGGACTGTCTACCCCCCTCTATCATCAAATACCTTCCATAGTGGCCCCTCTATTGACCTGACTATCTTTTCTCTCCATATTGCTGGTATATCCTCAATTATAGGAGCAATCAATTTTATTTCAACAATTATAAATATACATAATTCCAATATTTCCCTAGATAAAATTCCCTTATTAGTATGGTCTATTCTTATTACAGCTATTCTCCTTCTTCTGTCCCTACCTGTTCTAGCAGGAGCTATTACAATACTACTAACAGACCGAAATCTTAATACTTCATTTTTCGACCCTTCGGGAGGGGGAGATCCTATTTTATACCAACATTTATTTTGATTTTTTGGTCACCC
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Camponotus was found to be postive for Wolbachia.
Report Inappropriate Post