B-4 (Camponotus pennsylvanicus)

Sample information

Picture
Photos by: Alex S
Location
Collection date 09/15/2025
Captive / Cultivated? Wild-caught
Group Edmund Burke School
Observations

Caught the arthropod by the base of a tree in a park. Caught it nearing the first day of fall in the end of the summer. The temperature when I caught it was 74* F in a terrestrial habitat. The arthropod was some kind of ant with antenna, and it was mainly black with some brown.

Putative identification Arthropoda Insecta Hymenoptera

Methods

Extraction kit DNeasy (Qiagen)
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniOne
Buffer TBE
DNA stain GelGreen
Gel images
Protocol notes

DNA Extraction:

Arthropod was not hard to extract DNA from. Crushed easily. No mistakes recorded.

PCR:

Had to redo the PCR because the first one didn’t work. Worked the second time around.

Gel electrophoresis, Arthropod CO1:

In the arthropod gel we found a band signaling that B-4 was indeed an arthropod. In the B1-4 lanes of the gel electrophoresis, we had the corresponding DNA for each arthropod. In the W+ lane was a Wolbachia positive control and in the W- lane was a Wolbachia negative control, and in the H20 lane was a water control. We also found bands for arthropods B1-3 and our W+ and W- controls. Our controls worked meaning that we are confident in the results. We had no mistakes in this process such as contamination.

Gel electrophoresis, Wolbachia:

There was a band for Wolbachia in the B-4 lane of our gel. In the B1-4 lanes of the gel electrophoresis, we had the corresponding DNA for each arthropod. In the W+ lane was a Wolbachia positive control and in the W- lane was a Wolbachia negative control, and in the H20 lane was a water control. We also found bands for B3 and our W+ control. There was no band for arthropods B1-2 and our W- control. Our controls worked as intended meaning that we can confidently say that B-4 was infected with Wolbachia.

Results

Wolbachia presence Yes
Confidence level High
Explanation of confidence level

Our controls worked and we recorded no instances of contamination.

Wolbachia 16S sequence Download FASTA    Download AB1
TCATCCTTAGTTACCATCAGGTAATGCTGnnnnnnnnnnnGAAACTGCCAGTGATAAACTGGAGGAAGGTGGGGATGATG TCAAGTCATCATGGCCCTTATGGAGTGGGCTACACACGTGCTACAATGGTGGCTATAATGGGCTGCAAAGTCGCGAGGCT AAGCTAATCCCTTAAAAGCCATCTCAGTTCGGATTGTACTCTGCAACTCGAGTGCATGAAGTTGGAATCGCTAGTAATCG TGGATCAGCACGCCACGGTGAATACGTTCTCGGGTCTTGTACACACTGCCCGTCACGCCATGGGAATTGGT
BLAST at The Wolbachia Project   BLAST at NCBI
Arthropod COI sequence Download FASTA    Download AB1
AATTGGCTCCTCTATAAGAATAATCATTCGACTAGAGTTAGGATCTCCTGATTCACTAATTCTTAATGATCAAACTTTCA ATACCATCGTTACAAGTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTTTTATAATTGGGGGATTTGGTAATTTT TTAATTCCACTTATACTAGGATCTCCTGATATAGCTTACCCTCGTTTAAATAACATAAGATTTTGATTACTTCCCCCATC GATCTCCTTATTAATCCTAAGAAATTTTATTAATGAAGGATCTGGAACTGGTTGAACTATCTACCCCCCTCTATCATCAA ATACCTTCCATAGTGGCCCCTCTATTGACCTGACTATCTTTTCTCTCCATATTGCTGGTATATCCTCAATTATAGGAGCA ATCAATTTTATTTCAACAATTATAAATATACATAATTCCAATATTTCCCTAGATAAAATTCCCTTATTAGTATGATCTAT TCTTATTACAGCTATTCTCCTTCTTCTATCCCTACCTGTTCTAGCAGGCGCTATTACAATACTACTAACAGACCGAAATC TTAATACTTCATTTTTCGATCCCTCGGGAGGAGGAGATCCTATTTTATACCAACATTTATTTTGA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Hymenoptera was found to be postive for Wolbachia.
Report Inappropriate Post