Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/04/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | St. Albans School |
| Observations | Caught in a wooded, leafy area, flying low to the ground. Irratic movement, but calmed down a bit. Other bees flying around near it. |
| Putative identification | Arthropoda Insecta Hymenoptera Vespidae Vespula Vespula flavopilosa |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniPCR |
| Buffer | TBE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | It is possible that I did not properly extract DNA from the arthropod, and therefore, the Wolbachia DNA was not extracted. On the other hand, only one of the arthropods in the experiment was Wolbachia-positive, so it is unlikely mine had Wolbachia anyway. In addition, the positive control worked. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
AATTATTCGTTTAGAATTAAGATCTCCTGGAGCTTTAATTAATAATGATCAAATTTATAATACAATTATTACAGCCCATG CCTTTATTATAATTTTTTTTATAGTAATACCTTTTTTAGTTGGAGGATTCGGAAATTGATTAATCCCCTTAATATTAGGA GTGCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGATTACTTCCCCCTTCATTATTTTTATTAATTTTAAG AAATTTTATTGGAACCGGAGTAGGAACGGGATGAACTTTATACCCTCCCTTATCATCTATTGTTGGTCATGATTCACCTT CTGTAGATTTAGGAATTTTTTCTATTCATATTGCTGGAATTTCCTCAATTATAGGATCAATTAATTTTATTGTCACTATT TTAAATATAC
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Vespula flavopilosa was found to be negative for Wolbachia. |


EG Wolbachia 7L
7A
Millipede 7F
Coleoptera
Emily Yocum- Reticulitermes flavipes