Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 10/01/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Berkshire Community College |
| Observations | Found in Richmond Massachusetts alive outside a large barn on the side of a lightly forested field sample harvested 10/1/25 |
| Putative identification | Arthropoda Insecta Hymenoptera Vespidae Polistinae Polistes Polistes dorsalis |
Methods |
|
| Extraction kit | Monarch DNA extraction (NEB) |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Edvotek Gel Electrophoresis |
| Buffer | 1X TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | Are duplex PCR ran on October 16th that used the primers for Wolbachia 16s forward and reverse and the primers for arthropod _f (LCO1490) and Arthropod_R (HCO2198) They were ran at an annealing temperature of 49 degrees Celsius this was conducted twice once for are first round and second round to be u used in the gel electrophoresis trial Are first gel image was taken on october 23 10/23/25 and was run on 125 volts for 20 minutes the DNA ladder used : new England Biolabs 1 kb plus DNA ladder for safe stains (product#N0559S) are second gel image taken on 11/6/25 using the Edvotek gel Electrophoresis was ran at 125 volts for 25 minutes the DNA ladder used was the new England bio labs 1 KB plus DNA ladder for safe stains (product # N0559S) |
Results |
|
| Wolbachia presence | No |
| Confidence level | Low |
| Explanation of confidence level | It is unclear if the arthropod has Wolbachia because the two gels show different results. On the first gel, My confidence level of my negative wolbachia result is high. All my controls showed to be correct on the gel image and all protocols were followed. My confidence level for the second round of gel Electrophoresis is low even though my sample tested positive for Wolbachia and arthropod DNA our gel image showed signs of contamination (bands in the water lane) and our positive and negative arthropod controls did not show bands after the gel was ran. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download AB1
TGATCAGGAATAATTGGAAGATCTTTAAGATTAATTATTCGTTTAGAATTAGGAACACCTTTATCAATTATTAATAATGATCAAATTTATAACTCATTTATTACAGCACATGCATTAATTATAATTTTTTTTATAGTTATACCATTTATAATTGGAGGATTTGGAAATTGATTAATTCCTCTAATATTAGGTGCTCCAGATATAGCATTTCCACGAATAAATAACATAAGATTTTGATTATTACCTCCATCCCTATTACTACTAATTATTAGAAATATAAATGATTCAGGAGTAGGAACTGGATGAACTTTATATCCACCTTTATCATCTAATATAGGTCATAATTCATCATCAGTTGATTTTGCTATTTTTTCACTTCATATCGCAGGAATTTCATCAATTATAGGAGCTATTAATTTTATTGTAACAATTTTAAATATACATATTAAAACTTATTCATTAAATTTTTTACCAATATTTACATGATCAGTTTTAATTACTGCAATTTTACTTTTATTATCTTTACCTGTACTTGCTGGAGCAATTACAATATTATTAACTGATCGAAATATTAATACATCTTTCTTTGATCCATTAGGAGGTGGAGATCCAATTCTATTTCAACATTTATTTTGA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Polistes dorsalis was found to be negative for Wolbachia. |


Wolbachia Project
Alexander Devlin-Myrmica
Brookelynn Foote- Coccinellidae
Maile Bentz- Harmonia axyridis
Madison Adams – Harmonia axyridis