Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 10/01/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Berkshire Community College |
| Observations | It was just casually walking across first base on a baseball field. Once captured it hung from a thread in the middle of the vile. |
| Putative identification | Arthropoda Arachnida Araneae Philodromidae Philodromus Philodromus rufus |
Methods |
|
| Extraction kit | Monarch DNA extraction (NEB) |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Edvotek Gel Electrophoresis |
| Buffer | 1X TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | Our first PCR test was set up on 10/16/2025 and was a duplex reaction that used both the Wolbachia 16S and Arthropod CO1 primers. The annealing temperature was 49 degrees C. We used a DNA extraction protocol based on the insect adaptation of New England Biolabs’ Monarch Spin gDNA Extraction kit (Product #T3010) The specimen was incubated for 30 minutes in a hot water bath at 56 degrees C Our first Gel image was taken on 10/23/2025: -was run at 125 volts for ~36 minutes -used this DNA Ladder: New England Biolabs 1 kb Plus DNA Ladder for Safe Stains (product #N0559S) Our second PCR reaction was set up on 10/30/2025, used the same Taq polymerase as the first PCR reaction, and: -was a single reaction that used the Wolbachia_F and Wolbachia_R primers -used an annealing temperature of 55 degrees Celsius Gel image was taken on 11/6/2025 and: -was run at 125 volts for ~21 minutes -used the DNA Ladder: New England Biolabs 1 kb Plus DNA Ladder for Safe Stains (product #N0559S) |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | Due to a false positive DNA in the water during the first test further testing should be done with more care and accuracy. After completion of the second PCR(single) Test, our confidence has risen to a high. This is due to all controls are properly displayed, the two positive controls are displaying the correct bands, the presence of Wolbachia remained negative throughout both tests. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download AB1
GTGCTTGGGCAGCAATAGTTGGTACAGCAATAAGTGTATTAATTCGAATAGAATTAGGACAAGTAGGTAAATTTTTAGGTGATGATCATTTGTATAATGTTATTGTTACTGCTCATGCATTTGTCATAATTTTTTTTATAGTAATACCTATTTTAATTGGTGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGTGCCCCAGATATAGCATTTCCTCGAATAAATAATTTAAGTTTTTGATTACTTCCTCCATCATTATTATTATTATTTATTTCTTCTATAGTTGAAATAGGAGTTGGTGCTGGTTGAACAGTTTATCCTCCTTTAGCATCTGCTACAGGTCATGCTGGAAGTGCTGTTGATTTTGCTATTTTTTCATTACATTTAGCAGGAGCATCTTCTATTATAGGTTCCATTAATTTTATTTCTACTATTGTTAATATACGATCAAGTGGTATAAAAATAGATAAAGTTCCGTTATTTGTATGATCTGTTATAATTACCACTGTATTATTACTTTTATCATTACCTGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATTTTAATACTTCTTTCTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATTTCAACATTTGTTTTGA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Philodromus rufus was found to be negative for Wolbachia. |



Blattodea LB2
tenebrio molitor_To1
JC2
YSD2