Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/16/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Georgia Southern University |
| Observations | Collected sample in dirt with hands, it was covered by leaves. Insect is light in color. |
| Putative identification | Arthropoda Insecta Hymenoptera Formicidae Lasius Lasius nearcticus |
Methods |
|
| Extraction kit | |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | Other |
| Gel images |
|
| Protocol notes | DNA extraction kit of in-house reagents was used |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | My insect was sent for testing and came back as negative but was faint positive when tested in class. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence |
GCTTGATCAGGAATGGTCGGAACATCACTCAGAATACTAATTCGAACAGAATTAGGACAACCTTTGTGTG TGATTGGAGACGACCAGATCTACAACGTCATCGTTACCGCCCACGCATTCGTTATAATCTTCTTTATGGT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Lasius nearcticus was found to be negative for Wolbachia. |


(no title)
(no title)
(no title)
Spotted Lanterfly 2
Spotted Lanterfly 1