Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/25/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | NCSSM |
| Observations | This grasshopper was found in the pollinator garden at NCSSM-Morganton. It was collected at around 1:00 PM using a bug net and identified with the i-Naturalist app. |
| Putative identification | Arthropoda Insecta Orthoptera Acrididae Schistocerca |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniPCR |
| Buffer | TBE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | DNA Extraction: I removed the majority of the arthropod, other than the abdomen, then took great care while crushing to make sure everything was broken up. Gel Lanes:
Analysis: The controls all worked, and although it was faint, there was a band present for both the arthropod and Wolbachia DNA from the sample. |
Results |
|
| Wolbachia presence | Yes |
| Confidence level | Medium |
| Explanation of confidence level | Our controls all worked and a band was present for the presence of Wolbachia in this sample, but the band was very faint. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence |
ATATATTTTTCCCGAAAATAAAAAATAAAGGTTTGAGATTACTACCGACCTCTCTTACCCTTCTTCTTACATCTTATAGAGTGACCCTG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Schistocerca was found to be postive for Wolbachia. |


Ant like creature – Draft
Myrmaplata plantaleoides (Unsure) – Draft
leaf hopper nymph
Pheidole species (Minor Worker)
JTR 1