Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 11/13/2025 |
| Captive / Cultivated? | |
| Group | NCSSM |
| Observations | My partner and I located this Woolly Worm near our school. It was on the road leading up to our school’s grass hill. It was crawling slowly across the road. I collected it in the afternoon about 11:30 AM, and it was cloudy and slightly windy. |
| Putative identification | Arthropoda Insecta Lepidoptera Erebidae Pyrrharctia |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniPCR |
| Buffer | TBE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | DNA extraction: I crushed the arthropod thoroughly after dissecting it to just obtain its abdomen. I made sure to crush any hard parts. Gel electrophoresis lanes:
Analysis: My bands were faint, yet present. They are enough to deduce a reasonable conclusion about the nature of our species, but the confidence level is low. |
Results |
|
| Wolbachia presence | Yes |
| Confidence level | Medium |
| Explanation of confidence level | The gel bands were faint. There could have possibly been some contamination in the extraction process. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence |
GGGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCAGAATTAGGAATGCCCGGATCCTTAAT TGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATA CCTATTATAATTGGGGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCCCCTGATATAGCTTTCC CCCGAATAAATAACATAAGTTTTTGACTTTTACCCCCATCTTTAACTTTATTAATCTCAAGAAGAATTGT AGAAAATGGGGCAGGTACCGGATGAACCGTTTATCCCCCCCTTTCATCCAATATTGCCCACGGTGGTAGT TCTGTTGATTTAGCCATTTTTTCTTTACATCTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTA TTACCACAATTATTAATATACGATTAAATAATTTATCATTTGACCAAATACCTTTATTTGTTTGAGCGGT AGGAATTACTGCTTTTTTACTTCTTCTTTCTTTACCTGTTTTAGCAGGTGCTATTACTATACTTTTAACA GATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGGGGGGGAGATCCT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Pyrrharctia was found to be postive for Wolbachia. |


European Wasp
Small Honey Ant
7A
Millipede 7F