Sample information |
|||
| Picture |
|
||
|---|---|---|---|
| Location | |||
| Collection date | 11/13/2025 | ||
| Captive / Cultivated? | Wild-caught | ||
| Group | NCSSM | ||
| Observations |
|
||
| Putative identification | Arthropoda Insecta Hemiptera Rhopalidae Boisea Boisea rubrolineata | ||
Methods |
|||
| Extraction kit | DNeasy (Qiagen) blood and tissue kit | ||
| DNA extraction location | Whole arthropod | ||
| Single or Duplex PCR | Single Reaction | ||
| Gel electrophoresis system | MiniPCR | ||
| Buffer | TBE | ||
| DNA stain | |||
| Gel images |
|
||
| Protocol notes | DNA Extraction: Because our boxelder bugs were smaller than a grain of rice, we did not dissect them. Instead, we used a standard whole-body tissue extraction method by placing a small portion of the bug into the extraction buffer and mechanically breaking down the tissue to release genomic DNA. Gel Electrophoresis: We amplified the extracted DNA using both arthropod and Wolbachia primers. The arthropod primer served as a positive control to confirm that the PCR reaction worked and that our DNA extraction was successful. The Wolbachia-specific primer allowed us to test for the presence of Wolbachia DNA within the boxelder bug samples. After PCR, we ran the products through gel electrophoresis to visualize amplification results and determine whether Wolbachia was present. |
||
Results |
|||
| Wolbachia presence | No | ||
| Confidence level | Medium | ||
| Explanation of confidence level | The clear arthropod band indicates that our DNA extraction and PCR worked properly, which supports the reliability of the procedure. However, since there was no Wolbachia band and we lacked a confirmed Wolbachia-positive control to verify that the primers were functioning, we cannot be completely certain that the absence of amplification represents a true negative. |
||
| Wolbachia 16S sequence | |
||
| Arthropod COI sequence | Download AB1
GATCTGGTATAGTAGGTTCATCTTTAAGATGAATTATTCGTGTAGAATTAGGACAACCTGGTAGATTTAT TGGAGATGATCAAACATATAATGTAATTGTAACAGCACATGCTTTTATTATAATTTTCTTTATAGTTATG CCAATTATGATTGGTGGATTTGGGAATTGATTAGTGCCTTTAATAATTGGGGCCCCAGATATAGCATTTC CTCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCCCTTACTTTATTACTTGCAAGTAGTATAGT TGAAAGAGGGGCGGGAACTGGATGAACAGTTTACCCTCCTCTATCAAGAAATTTATCCCATAGAGGTGCC TCTGTAGATTTAGCAATTTTTTCATTACACTTAGCAGGTGTATCATCAATTTTAGGGGCTATTAATTTTA TTTCAACTATTATTAATATACGGCCAGCAGGAATAAGACCTGAACGAATACCATTATTTGTATGATCAGT AGGTATTACAGCCCTTCTGTTATTGTTGTCTTTACCTGTTTTAGCGGGGGCCATTACAATACTTTTAACT GACCGAAACTTTAATACATCTTTCTTTGATCCTACCGGAGGAG
BLAST at The Wolbachia Project BLAST at NCBI
|
||
| Summary | The Boisea rubrolineata was found to be negative for Wolbachia. | ||


Ant like creature – Draft
Myrmaplata plantaleoides (Unsure) – Draft
leaf hopper nymph
Pheidole species (Minor Worker)
JTR 1