Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/13/2022 |
| Captive / Cultivated? | Wild-caught |
| Group | KantiWil |
| Observations | |
| Putative identification | |
Methods |
|
| Extraction kit | Instagene Matrix |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | Yes |
| Confidence level | High |
| Explanation of confidence level | We worked closely and you can clearly see the line of Wolbachia. |
| Wolbachia 16S sequence | Download FASTA
Download AB1
GATAAACTGGAGGAAGGTGGGGATGATGTCAAGTCATCATGGCCCTTATGGAGTGGGCTACACACGTGCTACAATGGTGG CTACAATGGGCTGCAAAGTCGCGAGGCTAAGCTAATCCCTTAAAAGCCATCTCAGTTCGGATTGTACTCTGCAACTCGAG TGCATGAAGTTGGAATCGCTAGTAATCGTG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence |
|
| Summary | |


Common Eastern Bumble Bee (Bombus impatiens)
American Bird
Spotted crane fly
Wolbachia data
Meadow Katydid