Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/13/2022 |
| Captive / Cultivated? | Wild-caught |
| Group | KantiWil |
| Observations | in a spider web between two branches |
| Putative identification | Arthropoda Arachnida Araneae Pisauridae Pisaura Pisaura mirabilis |
Methods |
|
| Extraction kit | Instagene Matrix |
| DNA extraction location | Partial abdomen |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | The lines were not well visible on the gel. However, it was more visible than in the picture. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
AGTGGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATATCATTCCCCCGAATAAATAATTTGTCTTTTTGACTTTTACCTCCTTCTTTATTTTTATTATTTATATCTTCTATAGTAGAAATAGGAGTTGGTGCTGGTTGAACAGTTTATCCTCCTTTAGCATCTACAGTTGGTCATATAGGAAGATCTATAGATTTTGCTATTTTTTCTTTACATTTAGCTGGGGCTTCTTCTA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Pisaura mirabilis was found to be negative for Wolbachia. |


Pill Bug (Armadillidium vulgare) – Draft
Melanoplus Femurrubrum
Grasshopper – Orthoptera
Cisseps Fulvicollis
Aboud kanama