Southern green stink bug (005)

Sample information

Picture
Location
Collection date 09/28/2020
Captive / Cultivated? Wild-caught
Group Unterstrass
Observations
  • Terrestrial
  • Autumn
  • 15°C
  • Elevation – 571
Putative identification Hexapoda Insecta Hemiptera Pentatomidae Nezara Nezara viridula

Methods

Extraction kit Wizard SV (Promega)
DNA extraction location
Single or Duplex PCR
Gel electrophoresis system
Buffer
DNA stain
Gel images
Protocol notes

Results

Wolbachia presence No
Confidence level
Explanation of confidence level
Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
GAGCAGGATAGTAGGATCAGCAATAAGATTAATTATTCGAATTGAACTAGGACAACCCGGAAGATTTATTGGAGATGATCAAATTTATAATGTAGTAGTAACAGCTCACGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATAATTGGTGCTCCAGATATAGCATTCCCTCGAATAAACAATATAAGATTCTGGYTATTACCCCCATCATTAACCCTTTTAATAGTAAGAAGATTAGCAGAATCTGGAGCAGGAACAGGATGAACTGTTTATCCTCCTTTATCTAGTAATTTATCTCATAGAGGAGCCTCAGTGGATTTAGCTATTTTTTCATTACATCTAGCAGGAGTATCATCAATCTTAGGCGCAGTAAATTTCATTTCAACTATTATTAATATACGACCAACAGGTATAACTCCAGAACGAGTTCCACTATTTGTTTGATCAGTTGGGATCACAGCATTATTATTACTACTTTCATTACCTGTACTAGCAGGTGCAATTACAATATTATTAACAGATCGGAACTTTAATACATCATTCTTTGACCCTTCAGGAGGGGGAGATCCCATTCTTTATCAACACTTATTTTGATTTTTTGGTCACCCTGAAAGTTTAAAA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Nezara viridula was found to be negative for Wolbachia.
Report Inappropriate Post