Forest bug (014)

Sample information

Picture
Location No map location data available.
Collection date 09/28/2020
Captive / Cultivated? Wild-caught
Group Unterstrass
Observations
Putative identification Hexapoda Insecta Hemiptera Pentatomidae Pentatoma Pentatoma rufipes

Methods

Extraction kit Wizard SV (Promega)
DNA extraction location
Gel electrophoresis system
Buffer
DNA stain
Gel images
Protocol notes

Results

Wolbachia presence No
Confidence level
Explanation of confidence level
Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
ATATGAGCAGGTATAGTAGGATCAGCTATAAGTATTATTATTCGAATTGAATTAGGTCAACCCGGAAGATTTATTGGAGATGATCAAATTTATAATGTTGTAGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATGCCAATTATAATTGGTGGGTTTGGAAATTGACTAGTACCTTTAATAATTGGAGCACCTGATATAGCCTTTCCACGAATAAATAATATAAGATTTTGATTATTACCCCCTTCATTAACATTATTAATAATAAGAAGATTAACAGAAGCTGGAGCTGGTACTGGCTGAACAGTTTACCCCCCTTTATCTAGAAATTTATCACACAGAGGAACTTCAGTAGATTTAGCTATTTTTTCTCTTCATTTAGCAGGGGTTTCTTCAATTTTAGGTGCAGTAAATTTCATTTCAACAATTATAAATATACGCCCAACTGGAATAACTCCCGAGCGAATTCCTCTATTCGTTTGATCTGTTGGAATTACAGCTTTACTTTTATTGTTATCACTACCAGTATTAGCTGGAGCTATTACAATATTATTAACAGATCGAAATTTTAATACATCATTTTTTGACCCCTCAGGGGGTGGGGATCCCATTCTTTATCAACATTTATTTTGATTTTTTGGTCACCTG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Pentatoma rufipes was found to be negative for Wolbachia.
Report Inappropriate Post