Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 08/28/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | KantiWil |
| Observations | Habitat: Approx. 1.50m above the forest floor in an area where the rays of the sun reach well. |
| Putative identification | Arthropoda Insecta Hemiptera Aphididae Anoecia Anoecia corni |
Methods |
|
| Extraction kit | Instagene Matrix |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | The gel image shows that the sample is Wolbachia-negative. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
CTTCACTTAGAATATTAATTCGACTTGAACTTAGACAAATTAATTCTATTATTAATAATAACCAATTATATAATGTAATTATTACAATTCATGCWTTTATCATAATTTTTTTTATAACTATACCAATTGTTATTGGAGGTTTTGGAAATTGATTAATTCCTTTAATAATAGGATGTCCCCGATATATCWTTTCYACGACSTYAATAATATTAGATTTTGATTACTACCACCCTCATTAATAATAATAATCTGCAGATTTATTATTAATAATGGAACAGGAACAGGTTGAACTATTTACCCCCCTCTTTCTAATAATATTGCCCATAATAATATTTCAGTAGATTTAACTATTTTTTTCATTACATTTAGCAGGAATTTC
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Anoecia corni was found to be negative for Wolbachia. |


North American Wheel Bug
Cicurina (Meshweaver spider)
Tufted Clusterfly
Juvenile Pillbug
Dark-winged Fungus Gnat