Short-Horned Grasshopper

Sample information

Picture
Photos by: Owen M.
Location
Collection date 09/25/2025
Captive / Cultivated? Wild-caught
Group NCSSM
Observations

This grasshopper was found in the pollinator garden at NCSSM-Morganton. It was collected at around 1:00 PM using a bug net and identified with the i-Naturalist app.

Putative identification Arthropoda Insecta Orthoptera Acrididae

Methods

Extraction kit DNeasy (Qiagen)
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniPCR
Buffer TBE
DNA stain GelGreen
Gel images
Protocol notes

DNA Extraction: I removed the majority of the arthropod, other than the abdomen, then took great care while crushing to make sure everything was broken up. 

Gel Lanes:

  1. 100bp Ladder
  2. Empty
  3. American Bird Grasshopper Sample 2 Arthropod Primers
  4. American Bird Grasshopper Sample 2 Wolbachia Primers
  5. Goldenrod Soldier Beetle Sample 3 Arthropod Primers
  6. Goldenrod Soldier Beetle Sample 3 Wolbachia Primers
  7. American Bird Grasshopper Sample 3 Arthropod Primers
  8. American Bird Grasshopper Sample 3 Wolbachia Primers
  9. Empty
  10. Arthropod Positive Control
  11. Arthropod Negative Control
  12. Wolbachia Positive Control
  13. Wolbachia Negative Control

Analysis: The controls all worked, and although it was faint, there was a band present for both the arthropod and Wolbachia DNA from the sample.

Results

Wolbachia presence Yes
Confidence level Medium
Explanation of confidence level

Our controls all worked and a band was present for the presence of Wolbachia in this sample, but the band was very faint.

Wolbachia 16S sequence
Arthropod COI sequence
ATATATTTTTCCCGAAAATAAAAAATAAAGGTTTGAGATTACTACCGACCTCTCTTACCCTTCTTCTTACATCTTATAGAGTGACCCTG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Acrididae was found to be postive for Wolbachia.
Report Inappropriate Post