Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/02/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Benedictine University |
| Observations | Collected by Fall 2025 students |
| Putative identification | Arthropoda Insecta Hymenoptera Formicidae Formica Formica fusca |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Rear half |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | I am moderately confident in the results because the DNA bands observed in the gel did not match the expected band pattern for Wolbachia. Since the Wolbachia-specific band was not present, this suggests that the sample is likely not infected with Wolbachia. However, the presence of amplified DNA still indicates that the organism is most likely an arthropod, as the general arthropod primers successfully produced a band. My confidence is not high because there is still a possibility of experimental error, such as issues with PCR amplification or gel electrophoresis, which could affect the accuracy of the results. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
TTGGATCTTCTATAAGTATAATTATTCGATTAGAATTAGGTTCTTCAAATTCATTAATTAATAATGATCAAATTTATAAT TCTTTAGTAACTAATCATGGCTTTATTATAATCTTTTTTATAGTAATACCATTTATAATTGGTGGATTTGGAAATTTTCT AATTCCTTTAATATTAGGGTCACCAGATATAGCTTATCCTCGTATAAATAATATAAGATTTTGACTTTTACCTCCTTCCA TCACTCTATTACTTTTAAGAAACTTTATTAATGATGGTACTGGAACTGGATGAACTATCTACCCTCCTTTAGCTTCAAAT ATTTTTCATAATGGACCTTCTGTAGACTTAACAATTTTTTCTCTTCATATTGCCGGTATATCATCTATTTTAGGAGCTAT TAATTTTATTTCAACAATTATTAATATACATCATAAAAATTTTTCTATTGATAAAATTCCCCTACTTGTATGATCTATCT TAATCACTGCAATTTTACTTTTATTATCCCTTCCCGTTTTAGCAGGGGCTATTACAATATTATTAACTGACCGAAACTTA AATACTTCATTTTTTGACCCTTCAGGAGGGGGGGACCCAATTCTATATCAACATTTATTTTGATTTTTTGG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Formica fusca was found to be negative for Wolbachia. |
Centipede – MJAR
Fruitfly – MJAR
Ant – MJAR
Mosquito – MJAR
Bumblebee – MJAR