BRI-SKS Diptera

November 4, 2026

Sample information
Picture
Entry by: Sophia Schmidt
Location
Approximate location: 31.91, -81.02
Collection date 08/30/2026
Captive / Cultivated? Wild-caught
Group Georgia Southern University
Observations

Environment: The insect was found indoors on a dining room table in my kitchen. The area was dry and had food nearby, providing a possible source of food for the insect.

Location: My dining room table in my kitchen at my house (Savannah, Georgia, United States)
Putative identification Arthropoda Insecta Diptera

Methods
Extraction kit
DNA extraction location Partial abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain Other
Gel images
Protocol notes

DNA extraction kit of in-house reagents was used.

Results
Wolbachia presence Yes
Confidence level Low
Explanation of confidence level

I was confident that my bug would not have Wolbachia because it was a housefly, but my results showed that it actually did have Wolbachia! I was surprised by this outcome because it was the opposite of what I originally predicted. This helped me understand that scientific results do not always match our expectations and that testing is important to find out what is actually present.
Wolbachia 16S sequence
Arthropod COI sequence
CGTATTCNCCGNGNCGTGCTGATCCACGATTACTAGCGATTCCAACT TCATGCACTCGAGTTGCANAGTACAATCCGAACTGAGATGGCTTTTAAGGGATTAGCTTAGCCTCGCGACTTTGCAGCCC ATTGTAGCCACCATTGTAGCACGTGTGTAGCCCACTCCATAAGGGCCATGATGACTTGACATCATCCCCACCTTCCTCCA GTTTATCACTGGCAGTTTCCTTAAAGTCCCCANCATTACCTGATGGTAACTAAGGATGAGGGTTGCGCTCGTTGCGGGAC TTAACCCAACATCTCACGACACGANCTGACGACAGCCATGCAACACCTGTGTGAAACCCGGCCGAACCGACCCTATCCCT TCGAATAGGTATGA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Diptera was found to be postive for Wolbachia.
Report Inappropriate Post