Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/06/2023 |
| Captive / Cultivated? | Wild-caught |
| Group | Hawaii Community College |
| Observations | Small black ant, with lighter colored feet, living on a tree, walking in lines. |
| Putative identification | Arthropoda Insecta Hymenoptera |
Methods |
|
| Extraction kit | Edwards Buffer |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Edvotek Gel Electrophoresis |
| Buffer | TBE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | I am doing 5 samples of the same species from the same colony. |
Results |
|
| Wolbachia presence | Yes |
| Confidence level | High |
| Explanation of confidence level | In row 1 lanes 3-7 were all arthropod PCR, with positive bands in lanes 3 and 4. The 5-7 lanes did not correctly extract DNA so there was no band. Positive Wolbachia bands were shown in row 2 lanes 3 and 4. Row 2 in 5-7 lanes there was no Wolbachia band. All the samples of the same species tested positive for Wolbachia when the DNA was correctly extracted with a positive arthropod PCR CO1 band. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
GGAATAATTGGATCTTCTATAAGAATAATTATTCGTATTGAATTAGGAACCTGCAATTCTCTAATTAATAATGATCAAATTTATAATTCTATTGTTACAGGTCACGCATTTATTATAATTTTTTTTATAGTCATACCATTTATAATTGGTGGATTTGGAAATTTTTTAATTCCTTTAATATTAGGAGCCCCAGATATAGCATACCCACGAATAAATAATATAAGATTTTGACTATTACCACCCTCTATTATTATACTAACTATTAGTAATTTAATTGGATCAGGAGTAGGTACAGGATGAACAGTATACCCCCCTTTATCATCAAATATTTACCATAATGGACCCTCAGTAGATTTAGCAATTTTTTCTCTTCATATTGCTGGAATATCCTCTATTATAGGGGCTATTAACTTTATCTCAACTATCTTAAACATACACCATAAAAATTTAACTTTAGATAAAATTCCTTTATTAGTCTGATCTATTTTAATCACTGCAATTCTCTTATTACTCTCCCTCCCCGTCTTAGCCGGAGCTATTACCATACTTCTTACAGATCGAAATATCAATACTTCATTCTTTGACCCATGCGGGGGA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Hymenoptera was found to be postive for Wolbachia. |



Ant
Differential Grasshopper – Melanoplus differentialis
Pill Bug (Armadillidium vulgare) – Draft
Melanoplus Femurrubrum
Grasshopper – Orthoptera