Dermacentor variabilis

Sample information

Picture
Photos by: Andy C.
Location
Collection date 07/01/2022
Captive / Cultivated?
Group Talladega College
Observations
Putative identification Arthropoda Chelicerata Arachnida Ixodida Ixodidae Dermacentor Dermacentor variabilis

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain GelRed
Gel images
Protocol notes

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

PCR run with Wolbachia positive DNA and DNA from Wolbachia positive fruit flies

Wolbachia 16S sequence
Arthropod COI sequence Download AB1
NNNAANCTTATTTTCGGCAGTTCGAGCAGNGAGTCACNAGGAATAAGAATAAGAATTTTAATTCGAATAGAATTAAGCCAACCAGGAACTTTAATTGGAAATGATCAAATTTATAACGTAATTGTAACTGCTCATGCATTTATTATAATTTTTTTCATAGTTATGCCTATCATAATTGGTGGGTTTGGAAACTGACTTGTACCATTCATATAAGGAGCCCCAGATATAGCATTTCCACGAATAAATAATATAAGATTTTGACTATCACCTCCATCATTATTTTTACTTATAANTTCTTCATTAATTGAATCAGGAGCAGGAACAGGTAGAACTGTTTATCCCCCTTTATCAACAAATTTGTCTCACTATGGACCTGCAGTTGATTCAGCTATTTTTAGCCTTCATCTAGCAGGTGCTTCCACTTTTTAAGGAGCGATTAATTTTATCACCACATTAATAAATAAACGATCAATTGGTTTAACTCTGGAACGAATACTTTTTTTTGTTTGAGCAGTTTTAATAACAGCTATTTTACTTCTTCTTTCTCTCCTTTTTTAAGCAGGAGCCATAACAATTTTATAAACAGACCGTAACTTTAATACTTCCTTTTTCNACCCTGCAGGGGGGGAAGACCCCTTTTTGTATCACCTTTTTTTTTTGNTTTTTTGGCACCAAAAAAAAATAAAAAA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Dermacentor variabilis was found to be negative for Wolbachia.
Report Inappropriate Post