Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 05/28/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | Pingry School |
| Observations | We caught this Scolopocryptops sexspinosus covered in leaves about 2 inches underground. This centipede was orange in color and approximately an inch in length. Scolopocryptops sexspinosus, or the Eastern Red Centipede, is native to North America and is often found hiding under rotting wood or leaf litter. |
| Putative identification | Arthropoda Chilopoda Scolopendromorpha Scolopocryptopidae Scolopocryptops Scolopocryptops sexspinosus |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | The centipede was identified using the SEEK app. After identification, the centipede’s DNA was extracted, and we performed PCR for Wolbachia 16s ribosome and Arthropod COI gene. After amplifying the DNA, we then ran the DNA through a gel electrophoresis system, and scanned the gel to confirm or deny the existence of Wolbachia DNA and Arthopod DNA in our sample. The gel results don’t have a band at 708bp for the Arthopod COI gene, but the identity of the bug is confirmed from the sequencing results. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | There are no bands on the gel at 438bp, which is the expected band size for the Wolbachia 16S rRNA gene. Additionally, there is no sequencing product that confirms the presence of Wolbachia DNA in the sample. |
| Wolbachia 16S sequence |
N/A
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence | Download FASTA
Download AB1
GCTTGAGCATCAATAGCAGGAACTGCTCTTAGCCTAATTATCCGTTTAGAATTGAGTCAACCGGGAACCCTAATTGGTGA TGATCAAACTTACAATACTATTGTAACTGCTCACGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAG GATTCGGAAATTGATTAACCCCTTTAATACTAGGAGCTCCTGATATAGCTTTCCCTCGACTTAATAATATAAGTTTTTGA TTACTTCCTCCTTCATTAATACTTTTAATAGGATCAGCTATAGTTGAAAGAGGAGCCGGAACAGGATGAACAGTATACCC TCCTCTAGCAGCTAATCTTGCACACTCAGGACCTTCAGTAGATATAACAATTTTTTCATTACATCTTGCTGGAGTTTCTT CTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAACAAGAGGAATAGTAATAGAACGAGTTCCCCTT TTTGTCTGGGCAGTATTAATCACCACCATCCTTCTTTTATTATCTCTCCCTGTATTAGCAGGAGCAATTACAATATTACT TACAGATCGAAATTTTAATACTAGATTTTTTGATCCAGCAGGAGGAGGGGATCCTATTTTATACCAACATTTATTTTGAT TTTTTG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Scolopocryptops sexspinosus was found to be negative for Wolbachia. |


Wolbachia Project
Alexander Devlin-Myrmica
Brookelynn Foote- Coccinellidae
Maile Bentz- Harmonia axyridis
Madison Adams – Harmonia axyridis