Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 08/28/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | KantiWil |
| Observations | |
| Putative identification | Arthropoda Malacostraca Isopoda Trachelipodidae Trachelipus |
Methods |
|
| Extraction kit | Instagene Matrix |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | |
| Explanation of confidence level | CO – 708 bp was visible 16SrRNA – 438 bp wasn’t visible |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
TACAGCAATTCTCTTATTACTTTCACTACCGGTTTAGCAGGGGCCATTACTATRTTATTAACAGACCGTAATTTGAACACCTCTTTTTTCGACCCTAGGGAG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Trachelipus was found to be negative for Wolbachia. |





Differential Grasshopper – Melanoplus differentialis
Pill Bug (Armadillidium vulgare) – Draft
Melanoplus Femurrubrum
Grasshopper – Orthoptera
Cisseps Fulvicollis