Sample information |
|
Picture |
|
---|---|
Location | |
Collection date | 09/05/2024 |
Captive / Cultivated? | Wild-caught |
Group | Edmund Burke School |
Observations | Caught near the front door of my house. Caught during fall. It was 79 degrees Fahrenheit outside when caught. Terrestrial/urban habitat. Yellow and black stripes, 2 wings, abdomen, 6 legs, disconnected head. |
Putative identification | Arthropoda Hexapoda Insecta Hymenoptera Apidae Apis Apis mellifera |
Methods |
|
Extraction kit | DNeasy (Qiagen) |
DNA extraction location | Abdomen |
Single or Duplex PCR | Single Reaction |
Gel electrophoresis system | MiniOne |
Buffer | TBE |
DNA stain | GelGreen |
Gel images |
|
Protocol notes | DNA Extraction: It took a while to crush up the abdomen. There was a lot of debris. Had to add more Buffer ATL because some of it spilled while grinding. Forgot to change pipette tips between samples. PCR: Nothing went wrong, nothing to report. Gel Electrophoresis, Arthropod CO1: Lane 1 had the DNA ladder. Lane 2 had the DNA from our first arthropod, arthropod B-1. Lane 3 had DNA from arthropod B-2. Lane 4 had DNA from arthropod B-3. Lane 5 had our positive control. Lane 6 had our negative control. Lane 7 had H2O. The controls worked. Gel Electrophoresis, Wolbachia: Lane 1 had the DNA ladder. Lane 2 had DNA from our first arthropod, artropod B-1. Lane 3 had DNA from arthropod B-2. Lane 4 had DNA from arthropod B-3. Lane 5 had our positive control. Lane 6 had our negative control. Lane 7 had H2O. There was only 1 band present, in lane 5, which makes me think that something went wrong. |
Results |
|
Wolbachia presence | No |
Confidence level | High |
Explanation of confidence level | Almost all labs went smoothly. However, when extracting DNA, pipette tips were not switched between samples, but there was no evidence of contamination present. All controls worked during the gel electrophoresis lab, which means that any contamination was negligible. |
Wolbachia 16S sequence | |
Arthropod COI sequence | Download FASTA
Download AB1
TTATTATTCGAATAGAATTAAGATCCCCAGGATCATGAATTAGCAATGATCAAATTTATAATACAATTGTTACTAGTCAT GCATTCCTAATAATTTTTTTTATAGTTATACCATTTTTAATTGGAGGATTTGGAAATTGGCTTATTCCTTTAATACTAGG ATCACCTGATATAGCATTCCCCCGAATAAATAATATTAGATTTTGATTACTTCCTCCCTCATTATTTATACTTTTATTAA GAAATTTATTTTATCCAAGACCAGGAACTGGATGAACAGTATATCCACCATTATCAGCATATTTATATCATTCTTCACCT TCAGTAGATTTTGCAATTTTTTCTCTTCATATATCAGGAATTTCCTCAATTATAGGATCATTAAACTTAATAGTTACAAT TATAATAATAAAAAATTTTTCTATAAATTAT
BLAST at The Wolbachia Project BLAST at NCBI
|
Summary | The Apis mellifera was found to be negative for Wolbachia. |