Vespula squamosa

Sample information

Picture
Photos by: Asa D.
Location
Collection date 09/16/2024
Captive / Cultivated? Wild-caught
Group Edmund Burke School
Observations

Caught in a pleasant park with many flowers ready for pollination. Caught during fall, with an outside temperature of 72 degrees Fahrenheit. Terrestrial habitat. Yellow and black, fuzzy, 6 legs, abdomen, 2 wings, disconnected head.

Putative identification Arthropoda Hexapoda Insecta Hymenoptera Vespidae Vespula Vespula squamosa

Methods

Extraction kit DNeasy (Qiagen)
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniOne
Buffer TBE
DNA stain GelGreen
Gel images
Protocol notes

DNA Extraction: It took a while to crush up the abdomen. There was a lot of debris. Had to add more Buffer ATL because some of it spilled while grinding. Forgot to change pipette tips between samples.

PCR: Everything went according to the procedure. No errors made.

Gel Electrophoresis, Arthropod CO1: Lane 1 had the DNA ladder. Lane 2 had the DNA from our first arthropod, arthropod B-1. Lane 3 had DNA from arthropod B-2. Lane 4 had DNA from arthropod B-3. Lane 5 had our positive control. Lane 6 had our negative control. Lane 7 had H2O. The controls worked.

Gel Electrophoresis, Wolbachia: Lane 1 had the DNA ladder. Lane 2 had DNA from our first arthropod, artropod B-1. Lane 3 had DNA from arthropod B-2. Lane 4 had DNA from arthropod B-3. Lane 5 had our positive control. Lane 6 had our negative control. Lane 7 had H2O.

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

Almost all labs went smoothly. However, when extracting DNA, pipette tips were not switched between samples, but there was no evidence of contamination. All controls worked during the gel electrophoresis, so any contamination was negligible.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
ACTATTATTACTGCCCATGCATTTGTAATAATTTTCTTTATAGTTATGCCTTTCTTAATGGGAGGATTTGGAAATTGATT AATTCCTTTAATACTAGGTGTTCCAGATATAGCATTTCCTCGAATAAATAATATAAGATTCTGACTTTTACCCCCATCAT TATTCCTCTTAATTTTAAGAAATTTTATTGGAACAGGAGTAGGAACAGGATGAACTCTTTATCCTCCTCTTTCTTCTATT ACAGGTCATGATTCACCN
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Vespula squamosa was found to be negative for Wolbachia.
Report Inappropriate Post