Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/16/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | Edmund Burke School |
| Observations | Caught in a pleasant park with many flowers ready for pollination. Caught during fall, with an outside temperature of 72 degrees Fahrenheit. Terrestrial habitat. Yellow and black, fuzzy, 6 legs, abdomen, 2 wings, disconnected head. |
| Putative identification | Arthropoda Insecta Hymenoptera Vespidae Vespula Vespula squamosa |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniOne |
| Buffer | TBE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | DNA Extraction: It took a while to crush up the abdomen. There was a lot of debris. Had to add more Buffer ATL because some of it spilled while grinding. Forgot to change pipette tips between samples. PCR: Everything went according to the procedure. No errors made. Gel Electrophoresis, Arthropod CO1: Lane 1 had the DNA ladder. Lane 2 had the DNA from our first arthropod, arthropod B-1. Lane 3 had DNA from arthropod B-2. Lane 4 had DNA from arthropod B-3. Lane 5 had our positive control. Lane 6 had our negative control. Lane 7 had H2O. The controls worked. Gel Electrophoresis, Wolbachia: Lane 1 had the DNA ladder. Lane 2 had DNA from our first arthropod, artropod B-1. Lane 3 had DNA from arthropod B-2. Lane 4 had DNA from arthropod B-3. Lane 5 had our positive control. Lane 6 had our negative control. Lane 7 had H2O. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | Almost all labs went smoothly. However, when extracting DNA, pipette tips were not switched between samples, but there was no evidence of contamination. All controls worked during the gel electrophoresis, so any contamination was negligible. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
ACTATTATTACTGCCCATGCATTTGTAATAATTTTCTTTATAGTTATGCCTTTCTTAATGGGAGGATTTGGAAATTGATT AATTCCTTTAATACTAGGTGTTCCAGATATAGCATTTCCTCGAATAAATAATATAAGATTCTGACTTTTACCCCCATCAT TATTCCTCTTAATTTTAAGAAATTTTATTGGAACAGGAGTAGGAACAGGATGAACTCTTTATCCTCCTCTTTCTTCTATT ACAGGTCATGATTCACCN
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Vespula squamosa was found to be negative for Wolbachia. |



Japanese Burrowing Cricket, State College, PA – Wolbachia Results
Ant like creature – Draft
Myrmaplata plantaleoides (Unsure) – Draft
leaf hopper nymph
Pheidole species (Minor Worker)