Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 02/27/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Thomas Jefferson High School for Science and Technology |
| Observations | The carpenter ant was caught on a rock in front of the school that was near the soil. It was late winter, at around 45 F, with clouds and some wind blowing. It is red and it has 2 long antennae. It has short hair strands coming off of its body. It has 6 legs. |
| Putative identification | Arthropoda Insecta Hymenoptera |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniPCR |
| Buffer | TBE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download AB1
TACTTATCCGTTTAGAATTAGGTACTTCAAATTCATTAATTAATAATGATCAAGTTTTTAATTCTATAGTTACTAGACATGCTTTTATTATAATTTTTTTTATAGTCATACCTTTTATAATTGGTGGATTTGGAAATTTTTTAGTTCCTTTAATACTAGGATCTCCAGATATAGCCTATCCTCGAATAAATAATATAAGATTTTGACTTTTACCCCCTTCAATCAGTTTACTTTTATTAAGAAATTTCATTAATGACGGAGTGGGGACAGGATGAACTGTTTACCCTCCATTAGCTTCTAATATTTTTCATAATGGTCCTTCAGTTGACCTAACAATTTTTTCTCTGCATATTGCAGGGATATCCTCTATTCTAGGAGCTATCAATTTTATTTCAACAATTTTAAATATACGACAT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Hymenoptera was found to be negative for Wolbachia. |



Differential Grasshopper – Melanoplus differentialis
Pill Bug (Armadillidium vulgare) – Draft
Melanoplus Femurrubrum
Grasshopper – Orthoptera
Cisseps Fulvicollis