Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/04/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | Benedictine University |
| Observations | Collected by Fall 2024 students |
| Putative identification | Arthropoda Insecta Coleoptera Cantharidae Chauliognathus Chauliognathus pensylvanicus |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit. |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | Low |
| Explanation of confidence level | I chose a low confidence level because I had no band for the wolbachia. |
| Wolbachia 16S sequence | Download FASTA
Download AB1
TGCCACACTTGTGTAAAATCCGGCCGAACCGAGTAT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence |
|
| Summary | The Chauliognathus pensylvanicus was found to be negative for Wolbachia. |

Blattodea LB2
tenebrio molitor_To1
JC2
YSD2