Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 04/01/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | College of Eastern Idaho |
| Observations | Found inside of my house, recently deceased, surrounded by several others. |
| Putative identification | Arthropoda Insecta Coleoptera Coccinellidae Harmonia Harmonia axyridis |
Methods |
|
| Extraction kit | Edwards Buffer |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | The controls utilized worked well, ensuring the authenticity of this test. The results are clear and have little obscurity, and the DNA sample sequences show no issues. As such, I believe it is reasonable to conclude that the test results are a true negative. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
TTGGATATGGGCAGGAATAGTAGGAACATCGTTAAGTATTTTAATTCGGTTAGAATTAGGAACTAGAGGAAGATTAATTGGAAACGACCAAATTTATAATATAATTGTTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTAATACCTATTATAATTGGGGGTTTTGGAAATTGATTAGTTCCTTTAATAATTGGAGCTCCTGATATAGCATTTCCACGATTAAATAACATAAGATTTTGACTTTTACCCCCTGCTTTAACTCTTTTAATTTTAAGAACAATCGTAGAAATAGGGGCAGGAACAGGATGAACTGTTTACCCTCCTCTTTCTTCTAATTTAACACATAATGGGCCTTCAGTAGATTTAGTGATTTTTAGTTTACATTTAGCAGGAATTTCCTCAATTTTAGGTGCAGTAAATTTCATTTCAACTATTATAAATATACGTCCATTTGGTATAATACTTGATAAAACACCTTTATTTGTATGATCTGTTCTTATTACAGCAATTCTTTTATTACTATCACTACCAGTTCTTGCAGGAGCATTTACTATACTATTAACTGAC
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Harmonia axyridis was found to be negative for Wolbachia. |


Camponotus Pennsylvanicus
North American Wheel Bug
Cicurina (Meshweaver spider)
Tufted Clusterfly
Juvenile Pillbug