Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 04/01/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | College of Eastern Idaho |
| Observations | Was found inhabiting a lemon tree in a residential suburban environment. Found and captured in egg stage. |
| Putative identification | Arthropoda Insecta Hemiptera Aleyrodidae Trialeurodes Trialeurodes vaporariorum |
Methods |
|
| Extraction kit | Edwards Buffer |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | The Trialeurodes vaporariorum tests are located in the bottom gel, rightmost column, second and sixth rows (WspecF and CO1, respectively). The shakiness of the bars in the Gel EP suggests imperfections in the gel structure, most likely during formation. |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | Since the ab1 file shows clear contamination, and there are no controls, I can only be somewhat confident that the PCR the DNA has undergone is working. However, contamination would not be able to induce a false negative into a sample, and as such, I am still somewhat confident in this result. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
ATGTTCTTGTAACTTCCCATGCATTTATTATAATTTTTTTTATGACTATGCCTCTTGTTATTGGTGGGTTCGGGAACTGGCTGGTTCCTCTTATGGTTGGGGCTCCTGATATGGCGTTTCCTCCAATAAATAATCTTAGATTTTGGCTGTTGNTTCCTTCTTTGTTTTTTATGCTTGTTAGACTTTTGATTGATAGGGGAAGCGGCACGGGTTGAACTGTTTATCCCCCCCTATCTATAAGGCTGTCACATAGGGGGAATTCTGTCGATTTTTCTATTATNTCTTTGCACGTTGCTGGAATTTCTTCTATTTTGGGATCACTTAATTTTATCCTGACTATTGTAAACATGCAGGCGTTGGGCATAAAAATGGAGTTTTAATCTTTGTTTGTCTGATCTGTGTTTATTACTGTTTTCTTGCTTTTAATTTCTCTTCCTGTGTGGGCAGGGGCAATTACTATACTTTTACTGGATNGTAATTTTAA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Trialeurodes vaporariorum was found to be negative for Wolbachia. |


Ant
Differential Grasshopper – Melanoplus differentialis
Pill Bug (Armadillidium vulgare) – Draft
Melanoplus Femurrubrum
Grasshopper – Orthoptera