Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 05/30/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Pingry School |
| Observations | The bug was found in the forest part of Pingry School, under a big rock. The bug moved very slowly when the rock was lifted. It had a white body color, 2 eyes, and was smaller than a grain of rice. |
| Putative identification | Arthropoda Insecta Hemiptera Cixiidae Melanoliarus Melanoliarus placitus |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | 1X TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | First, DNA was extracted from the bug, then purified the DNA, and then eluted the DNA. After starting PCR. After PCR was created and loaded the gel was loaded. After we did PCR purification and then sequencing. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | I am confident that my bug is not Wolbachia positive because when looking at the gel, my Wolbachia sample matched my negative control, showing that it is not Wolbachia positive. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
NNNNNNNNGNNNNNNNNNNNNNNNNNNNNNGACTTATNNGNNNNATNNNANNAATAATTATCCGAATAGAATTAACTCAT CCNGGCTCAATCATCAACAACGATCAAATCCACAACATAATANTAACCTCACATGCTTTCATTATGATCTTCTTTATAGT NATACCAATTATAATTGGAGGATTCGGAAACTGATTAGTCCCAATTATAATTGGAGCTCCNGACATAGCATTCCCCCTAA TAAACAACATAAGATTTTGACTCCTACCACCTTCTTTAATATTAATAATTTCCAGAAGATTAACAGGATCTGGAGCAGGG ANNGGGNGAACAGTATATCCACCTCTGGCTAGATTAACAGCCCATTCAGGCCCATCTGTAGAGATNACAATTTTTTCTCT CCCTATTGNANGTGTTAAATCAATCCTAGGAGNAATCTACTTTATCTCNACTATTTTAAATATACGATCANAAGAAATAA CACCNGAAAAAACACCCCTATTTTGTTGATAAGTTCTAATTACAGCNATTTTNCTATTAATTTCNCTNCCCNTGTNNTAG GAGCNATTANTGTATTACTTATNGACCGAAATTTTCATANAACATTCTTTGATCCTACCTGAGGAGGAGATCNACTNNTA NTTANCAATTATTCTGATGATTTGNTNNACNGNNTNNAANTAGN
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Melanoliarus placitus was found to be negative for Wolbachia. |


Blattodea LB2
tenebrio molitor_To1
JC2
YSD2