Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 06/27/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Pingry School |
| Observations | A black bug with a reddish orange color on its back. It had 2 black lines going down vertically from its head to the bottom of the insect. It had a spiky head and 6 legs. |
| Putative identification | Arthropoda Insecta Coleoptera Coccinellidae Harmonia Harmonia axyridis |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | 1X TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | Extracted DNA using the DNeasy extraction kit. Then, created a 2% agarose gel using 1X TAE buffer and agarose. 2 rows of wells were made, the top wells were to test for Arthropod DNA, the bottom wells were to test for Wolbachia DNA. PCR was completed on the samples to get them ready for gel electrophoresis. The first column was for the ladder, the second was my bug sample, the third and fourth were positive and negative arthropod controls, and the last column was a negative DNA control. |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | The insect definitely was an arthropod, because the gel showed the sample to be positive for arthropod DNA in the second column of the top row. However, in the bottom row of wells, there was no Wolbachia present, meaning the insect did have arthropod DNA, but there was no Wolbachia present. Also, the DNA sequencing came back with low quality, and when blasted stated the insect was a Homo sapien. This is where the medium confidence comes from |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
GAGATGGTGCTNNAAGGNAACTTGAGTTTANCTGTAATATTTCGCTTGTATTTACAAGANTAATGCNTTCATGTGAATTG AGAAANTACTATGTTGTTATTACAATGGTTTTGTTTTGACTTTTTTTCTAACAAAACTATTTCATTGCATCTTACTAATC ATTTAAAAACCAGAAGAAAATGCATATTTGATTAAAATAGATCTCTTAANTCTAGTTCTCTTTTATGTATCAGGACTTGT GGGTTTTATTTTTANAAGGAAACCTTAATCACTGAAAGCAAAGGTGAAACCATCCTCCACNGAGGCTTNTCAGNAGGTGG GCGGACCATCCTGCAAAACGACCACTCACTACTGGCCAGCANCTGGGCTTCTGCNGAACTTCATGCCCCACCAGGTAAAG CAGGCCTCCNAAAGTCCAGTTTGNATGTTTTGGACTTTG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Harmonia axyridis was found to be negative for Wolbachia. |


European Paper Wasp
Woodworm Ant