Pagaronia Minor (Cicadellidae)

June 5, 2025

Sample information
Picture
Photos by: Jasmine Z
Location
Collection date 05/30/2025
Captive / Cultivated? Wild-caught
Group Pingry School
Observations

The bug was hopping from grass blade to blade, somewhat camouflaging itself with the greenery around it. It looked a little lighter than the green grass and more transparent, so if you looked closely, you could see it. It barely flew much, mainly just hopping and using it’s wings to glide or gain a bit more air. It primarily stayed low and still, only hopping away when it felt it was trying to be grabbed.
Putative identification Arthropoda Insecta Neuroptera Chrysopidae

Methods
Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes

Extract the DNA using the DNeasy (Qiagen) blood and tissue kit, and then amplify the Arthropod COI gene and the potential Wolbachia gene using PCR. After DNA was amplified, it was stained with SYBR Safe and run through a gel. Then, samples that had bands for COI or Wolbachia were purified using the QIAquick PCR Purification kit and sent out for sequencing.

Results
Wolbachia presence No
Confidence level High
Explanation of confidence level

DNA Extraction and amplification were successful due to the presence of a COI band in the A/02 lane. However, in the W/02 lane, no Wolbachia band was apparent. Thus, since nothing else went wrong, it can be concluded that the Pagaronia Minor has no Wolbachia infection.
Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
GGGTNTAATACTTANAATATTGATTCNAGTAGAATTAGCACAACCTGGACCTTTACTTAATAATGATCAAGTATACAATG TAATTGTGACTTCTCATGCATTTATCATGATTTTTTTTATAGTTATACCAATTATAATCGGTGGTTTTGGGAATTGATTA TTACCATTAATAATTGGTGCACCAGATATAGCATTTCCACGAATAAATAATATAAGTTTTTGGTTATTACCTCCTTCCCT AACATTGCTATTAATTAGTTCTATAGNANNNATAGGTGCTGGNACNNGCTGAACAGNATACCCCCCACTATCNTCTAATA TTGCTCACTCTGGTCCAAGAGTGGATTTAGCTATTTTCTCGCTTCATTTAGCAGGAATCTCATCTATTTTGGGGGCAGTA AACTTCATTACAACAGNAATTAATATGCGTAGAATTGGGATAAAATTANACCGGACTCCTTTATTCGTCTGATCTGTTTT AATTACAGCAATTCTTTTACTTCTATCTCTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATATTA ATACCTCCTTTTTTGATCCGTCCGGGGGTGGNGACCCTATTTTATACCAACATCTATTTTGATTTTTTG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Chrysopidae was found to be negative for Wolbachia.
Report Inappropriate Post