Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 08/05/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Pingry School |
| Observations | It was found, perhaps injured, not flying, and not moving much on a gravel hiking trail in the woods. It was just standing there in the middle of the path. Thus, it was easy to pick up off the ground and capture. |
| Putative identification | Arthropoda Insecta Hymenoptera Pemphredonidae Spilomena Spilomena beata |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | 1X TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | Extract the DNA using the DNeasy (Qiagen) blood and tissue kit, and then amplify the Arthropod COI gene and the potential Wolbachia gene using PCR. After DNA was amplified, it was stained with SYBR Safe and run through a gel. Then, samples that had bands for COI or Wolbachia were sequenced using the QIAquick PCR Purification kit and sent out for sequencing. |
Results |
|
| Wolbachia presence | Yes |
| Confidence level | Medium |
| Explanation of confidence level | Gel results were convincing due to the A/03 lane having a COI band and the W/03 lane having a Wolbachia band. Thus, DNA extraction, amplification, and loading the gel had no issues. However, sequencing for the COI gene came back inconclusive, and was unable to identify the arthropod. Sequencing for Wolbachia came back good and confirmed the presence of the infection. Ultimately, since the arthropod was not precisely identified, my confidence level is medium. |
| Wolbachia 16S sequence | Download FASTA
Download AB1
CCCTCATCCTTAATTACCATCCGGTAAGGCTGGGGATTTTAAGGAAACTGCCAGTGATAAACTGGAGGAAGGTGGGGATG ATGTCAAGTCATCATGGCCCTTATGGACTGGGCTACACACGTGCTGANTGNTGGCTACAATGGGCTGCNAAATCGCGAGG CTAAGCTAATCCCTTAAAANCCATCTCATTTCGGATTGTACTCTGCAACTCAAGTGCGTGATCTTGGAATCACTAATAAT CGTGGATCACCACGCCACGTTGAATACGTTCTCGGGTCTTGTACACACTGCCCGTCAA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence | Download FASTA
Download AB1
TGGNTTTGGTATTNCAGGGANACCTCNATCACAGNNANTNCTGTCGCCNCNCCNGGANANTNTNTTATGATAAATCCTGA ACTGCACTTATGANCNCTNNTCAAACTTTCTGATATCNTGATNCAATGGCTGAAGGAAGGTGTNCNGATNNANNCCATGA GTTCAAAGAAGGCCAAGATGAGCTGNCGGAGCAGGATGAAATGTTCANAGGCCGGACTGCAGTGATTGCTGATCAAGTGA TANTTGGCAATGCCTCTTTGCGGCTGANNAACTTGTAACTCACAGATGCTGGCACCTACNAATGTTATATCATCACTTCA AGANGCA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Spilomena beata was found to be postive for Wolbachia. |



European Paper Wasp
Woodworm Ant