Spilomena Beata

Sample information

Picture
Entry by: Jasmine Z
Location
Collection date 08/05/2025
Captive / Cultivated? Wild-caught
Group Pingry School
Observations

It was found, perhaps injured, not flying, and not moving much on a gravel hiking trail in the woods. It was just standing there in the middle of the path. Thus, it was easy to pick up off the ground and capture.

Putative identification Arthropoda Insecta Hymenoptera Pemphredonidae Spilomena Spilomena beata

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes

Extract the DNA using the DNeasy (Qiagen) blood and tissue kit, and then amplify the Arthropod COI gene and the potential Wolbachia gene using PCR. After DNA was amplified, it was stained with SYBR Safe and run through a gel. Then, samples that had bands for COI or Wolbachia were sequenced using the QIAquick PCR Purification kit and sent out for sequencing.

Results

Wolbachia presence Yes
Confidence level Medium
Explanation of confidence level

Gel results were convincing due to the A/03 lane having a COI band and the W/03 lane having a Wolbachia band. Thus, DNA extraction, amplification, and loading the gel had no issues. However, sequencing for the COI gene came back inconclusive, and was unable to identify the arthropod. Sequencing for Wolbachia came back good and confirmed the presence of the infection. Ultimately, since the arthropod was not precisely identified, my confidence level is medium.

Wolbachia 16S sequence Download FASTA    Download AB1
CCCTCATCCTTAATTACCATCCGGTAAGGCTGGGGATTTTAAGGAAACTGCCAGTGATAAACTGGAGGAAGGTGGGGATG ATGTCAAGTCATCATGGCCCTTATGGACTGGGCTACACACGTGCTGANTGNTGGCTACAATGGGCTGCNAAATCGCGAGG CTAAGCTAATCCCTTAAAANCCATCTCATTTCGGATTGTACTCTGCAACTCAAGTGCGTGATCTTGGAATCACTAATAAT CGTGGATCACCACGCCACGTTGAATACGTTCTCGGGTCTTGTACACACTGCCCGTCAA
BLAST at The Wolbachia Project   BLAST at NCBI
Arthropod COI sequence Download FASTA    Download AB1
TGGNTTTGGTATTNCAGGGANACCTCNATCACAGNNANTNCTGTCGCCNCNCCNGGANANTNTNTTATGATAAATCCTGA ACTGCACTTATGANCNCTNNTCAAACTTTCTGATATCNTGATNCAATGGCTGAAGGAAGGTGTNCNGATNNANNCCATGA GTTCAAAGAAGGCCAAGATGAGCTGNCGGAGCAGGATGAAATGTTCANAGGCCGGACTGCAGTGATTGCTGATCAAGTGA TANTTGGCAATGCCTCTTTGCGGCTGANNAACTTGTAACTCACAGATGCTGGCACCTACNAATGTTATATCATCACTTCA AGANGCA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Spilomena beata was found to be postive for Wolbachia.
Report Inappropriate Post