Sample information |
|
Picture |
![]() |
---|---|
Location | |
Collection date | |
Captive / Cultivated? | Wild-caught |
Group | Neuqua Valley High School |
Observations |
|
Putative identification | Arthropoda Hexapoda Insecta Hymenoptera |
Methods |
|
Extraction kit | Puregene (Qiagen) |
DNA extraction location | |
Single or Duplex PCR | |
Gel electrophoresis system | MiniPCR |
Buffer | TBE |
DNA stain | GelGreen |
Gel images |
![]() ![]() |
Protocol notes | |
Results |
|
Wolbachia presence | No |
Confidence level | High |
Explanation of confidence level | The insect control worked and had the fluorescent tag, whereas for the Wolbachia control there was no fluorescent tag, and I am confident that there were no errors while collecting. |
Wolbachia 16S sequence | |
Arthropod COI sequence | Download FASTA
Download AB1
TTTTTAGTATATTATATATTCATCTGGCTTTTTGGATGCACCGATGAGAGATCCAGTTTTCACAGCGAACGCTATGGCTT
BLAST at The Wolbachia Project BLAST at NCBI
|
Summary | The Hymenoptera was found to be negative for Wolbachia. |