NV55 Black carpenter ant

April 14, 2021

Sample information
Picture
Photos by: Aaryan P
Location
Collection date
Captive / Cultivated? Wild-caught
Group Neuqua Valley High School
Observations
  • Found in dirt and mulch
  •  near plants
  •  tried to dig itself underground 
Putative identification Arthropoda Hexapoda Insecta Hymenoptera

Methods
Extraction kit Puregene (Qiagen)
DNA extraction location
Single or Duplex PCR
Gel electrophoresis system MiniPCR
Buffer TBE
DNA stain GelGreen
Gel images
Protocol notes

Results
Wolbachia presence No
Confidence level High
Explanation of confidence level

The insect control worked and had the fluorescent tag, whereas for the Wolbachia control there was no fluorescent tag, and I am confident that there were no errors while collecting.
Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
TTTTTAGTATATTATATATTCATCTGGCTTTTTGGATGCACCGATGAGAGATCCAGTTTTCACAGCGAACGCTATGGCTT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Hymenoptera was found to be negative for Wolbachia.
Report Inappropriate Post