Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | |
| Captive / Cultivated? | Wild-caught |
| Group | Neuqua Valley High School |
| Observations |
|
| Putative identification | Arthropoda Insecta Hymenoptera |
Methods |
|
| Extraction kit | Puregene (Qiagen) |
| DNA extraction location | |
| Single or Duplex PCR | |
| Gel electrophoresis system | MiniPCR |
| Buffer | TBE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | The insect control worked and had the fluorescent tag, whereas for the Wolbachia control there was no fluorescent tag, and I am confident that there were no errors while collecting. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
TTTTTAGTATATTATATATTCATCTGGCTTTTTGGATGCACCGATGAGAGATCCAGTTTTCACAGCGAACGCTATGGCTT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Hymenoptera was found to be negative for Wolbachia. |



Umbrella Wasp
Fannia Canicularis
Oulema Obsucra JM2
Collembola
Linyphiidae BK1