Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/11/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Penn State Lehigh Valley |
| Observations | Hand caught while predating on a Honeybee in a flowered mulch patch. Placed into plastic sandwich bag and frozen for 20 minutes after capture. Average sized Yellow Jacket with stripped and spotted thorax. Two bronze-colored wings attached to the abdomen. stinger not visible on specimen. Also processes two antennae protruding from the head and 6 legs attached to the abdomen. |
| Putative identification | Arthropoda Insecta Hymenoptera Vespidae Vespula Vespula germanica |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | 1X TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | Lane 1: Arthropod 1 Wol + COI1 -> Crab Spider Lane 2: Arthropod 2 Wol + COI1 -> Yellow jacket Lane 3: Wol (+) Wol + COI1 Lane 4: Wol (-) Wol +COI1 Lane 5. gDNA control Wol +COI1 Lane 6: Water Control Wol + COI1 Lane 7: DNA Standard Taq Polymerase: GoTaq Master Mix: measured in Microliters
Thermal Cycle
|
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | Our Gel results show negative for the Wolbachia DNA however the band showing the DNA Bases was very faded, so it is possible that there was an error with PCR that could affect results. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence |
TTTAATTAATAATGATCAAATTTATAATACTATTATTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTTATACCTT TTTTAGTTGGAGGATTTGGAAATTGATTAATCCCTTTAATATTAGGTGTTCCTGATATAGCATTTCCTCGAATAAATAAT ATAAGATTTTGATTATTACCTCCATCCTTATTTTTATTAATCTTAAGAAATTTTATTGGAACCGGAGTAGGGACAGGATG AACTCTGTACCCTCCTTTATCATCAATTGTAGGACATGACTCTCCCTCTGTAGACTTAGGAATTTTTTCTATCCATATTG CTGGAATTTCATCAATTATAGGTTCAATTAATTTTATTGTTACTATTTTAAATATACACACAAAAACACATTCACTAAAT TTTCTTCCTTTATTTTCATGATCAATTTTAATTACAGCAATTCTTCTCTTGTTATCTCTACCAGTTCTTGCAGGAGCAAT TACTATACTTCTTACAGACCGTAATTTAAATACATCTTTCTTTGATCCTGCAGGCGGAGGTGACCCAATTTTATACCAAC ATTTATTTTGATTTTTTGGTCACCTGGNAAGTTT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Vespula germanica was found to be negative for Wolbachia. |


Ant like creature – Draft
Myrmaplata plantaleoides (Unsure) – Draft
leaf hopper nymph
Pheidole species (Minor Worker)
JTR 1