German Wasp (Vespula Germanica)

Sample information

Picture
Entry by: Dylan Ephault
Location
Approximate location: 40.56, -75.40
Collection date 09/11/2025
Captive / Cultivated? Wild-caught
Group Penn State Lehigh Valley
Observations

Hand caught while predating on a Honeybee in a flowered mulch patch. Placed into plastic sandwich bag and frozen for 20 minutes after capture. Average sized Yellow Jacket with stripped and spotted thorax. Two bronze-colored wings attached to the abdomen. stinger not visible on specimen. Also processes two antennae protruding from the head and 6 legs attached to the abdomen.

Putative identification Arthropoda Insecta Hymenoptera Vespidae Vespula Vespula germanica

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes

Lane 1:  Arthropod 1 Wol + COI1 -> Crab Spider

Lane 2: Arthropod 2 Wol + COI1 -> Yellow jacket

Lane 3: Wol (+) Wol + COI1

Lane 4: Wol (-) Wol +COI1

Lane 5. gDNA control Wol +COI1

Lane 6: Water Control Wol + COI1

Lane 7: DNA Standard

Taq Polymerase: GoTaq

Master Mix: measured in Microliters

  1. Water: 45.5
  2. GoTaq: 87.5
  3. F primer: 14
  4. P primer: 14
    1. 23 Microliters of MM in each PCR tube

Thermal Cycle

  1. Denaturation: 98 degrees Celsius
  2. Annealing: 45-65 degrees Celsius
  3. Extension: 72 degrees Celsius
    1. Repeat roughly 30x = Billions

Results

Wolbachia presence No
Confidence level Medium
Explanation of confidence level

Our Gel results show negative for the Wolbachia DNA however the band showing the DNA Bases was very faded, so it is possible that there was an error with PCR that could affect results.

Wolbachia 16S sequence
Arthropod COI sequence
TTTAATTAATAATGATCAAATTTATAATACTATTATTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTTATACCTT TTTTAGTTGGAGGATTTGGAAATTGATTAATCCCTTTAATATTAGGTGTTCCTGATATAGCATTTCCTCGAATAAATAAT ATAAGATTTTGATTATTACCTCCATCCTTATTTTTATTAATCTTAAGAAATTTTATTGGAACCGGAGTAGGGACAGGATG AACTCTGTACCCTCCTTTATCATCAATTGTAGGACATGACTCTCCCTCTGTAGACTTAGGAATTTTTTCTATCCATATTG CTGGAATTTCATCAATTATAGGTTCAATTAATTTTATTGTTACTATTTTAAATATACACACAAAAACACATTCACTAAAT TTTCTTCCTTTATTTTCATGATCAATTTTAATTACAGCAATTCTTCTCTTGTTATCTCTACCAGTTCTTGCAGGAGCAAT TACTATACTTCTTACAGACCGTAATTTAAATACATCTTTCTTTGATCCTGCAGGCGGAGGTGACCCAATTTTATACCAAC ATTTATTTTGATTTTTTGGTCACCTGGNAAGTTT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Vespula germanica was found to be negative for Wolbachia.
Report Inappropriate Post