Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/11/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Penn State Lehigh Valley |
| Observations | Found it on the leaves of the bushes. This insect prefers to fly and jump from one location to another. |
| Putative identification | Arthropoda Insecta Hemiptera Flatidae |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | 1X TAE |
| DNA stain | SYBR Green |
| Gel images |
|
| Protocol notes | Lane 1 is the DNA ladder; lane 2 is the target arthropod, siphanta acuta; lane 3 is my colleague’s arthropod; lane 4 is the positive wolbachia control; lane 5 is the negative wolbachia control; lane 6 is the wolbachia sampleDNA control (contain arthropod DNA); lane 7 is the water control; lane 8 is empty
|
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | I’m confident in the results. Because the bonds (lane 2) are bright and easy to identify, the controlled group (lane 4-7) reconfirms the validation.
|
| Wolbachia 16S sequence |
N/A
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence |
TGGATTTGATCNGGACTAGTAGGAATAATAATAAGAATAATTATTCGAATAGAACTATCTCAACCAGGATCA ATAATCAAAAATGACCAAATTTATAACACAATTGTAACTTCACATGCATTTGTAATAATCTTTTTTATAGTTATACCAAT TATAATTGGTGGTTTTGGAAACTGGCTTGTTCCTCTTATAATTGGAGCACCAGATATAGCTTTCCCACGAATAAACAATA TAAGTTTTTGACTTTTACCAATATCAATTACATTATTAATTGCAAGATCAACAGCAGCTTCAGGAACAGGAACAGGATGA ACTGTATACCCACCTCTTTCGGCTCAAGAAGCACATTCAGGACCATCAGTAGACTTAACAATTTTTTCATTACACATTGC AGGTATTAGATCAATTATAGGAGCAATCAATTTTATTTCAACCATTATAAATATACGAATCAAAGGAATAACAATAGAAA AAACCCCCTTATTTTGTTGATCAGTACTAATTACAGCAATCCTTTTACTAGTTTCTTTACCAGTACTAGCCGGAGCAATC ACAATATTAATTATAGACCGAAATTTAAATACTTCATTTTTTGATCCATCAGGAGGAGGTGATCCTATTCTGTATCAACA CTTATTCTGATTTT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Flatidae was found to be negative for Wolbachia. |







American Bird
Spotted crane fly
Wolbachia data
Meadow Katydid
Blattella germanica