Ant found in 01201

Sample information

Picture
Entry by: Gladis Z
Location
Collection date 09/29/2025
Captive / Cultivated? Wild-caught
Group Berkshire Community College
Observations

Arthropod was collected outdoors in a dirt area.

Putative identification Arthropoda Insecta Hymenoptera Formicidae Lasius Lasius alienus

Methods

Extraction kit Monarch DNA extraction (NEB)
DNA extraction location Whole arthropod
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system Edvotek Gel Electrophoresis
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes

We used a dna extraction protocol based on the insect adaptation of New England biolabs monarch spin gDNA extraction kit (product #T3010)

the specimen was incubated for 30 minutes in a hot water bath at 56 degrees C.

Our first PCR was set up on 10/14/25 and was a duplex reaction because we used both the arthropod CO1 and Wolbachia 16S Primers together. Used an annealing temperature of 49 degrees Celsius. Used this TAQ polymerase: New England Biolabs OneTaq Hot start Quick Load 2X Master Mix with standard buffer  (#M0488S).
Differed from the written protocol: used 88 ul of Taq master mix

Our first gel image was taken on 10/21/25 and was run at 125 volts for 22 minutes. Used this DNA Ladder : New England Biolabs 1 kb Plus DNA Ladder for safe stains (product #N0559S)

Our second PCR reaction was set on 10/28/25 used the same Taq polymerase as the first PCR reaction, and was a single reaction that used Wolbachia F and R primers. Used an annealing temperature of 55 degrees Celsius.
Differed from the standard protocol in that : used 88uL instead of 87.5

Our second gel image was taken on 11/4/25 and was run at 125 volts for 27 minutes.
used this DNA ladder: New England BioLabs 1kb plus DNA Ladder for Safe Stains (product # N0559S)

Results

Wolbachia presence No
Confidence level Medium
Explanation of confidence level

Confidence level will increase with more testing to prove accurate results. Controls matched expectations, except +arthropod control was not detected at all. My arthropod had a band around 700bp but no band for Wolbachia.

11/4/25 Confidence level for the second gel electrophoresis is high moderate. My arthropod still detected no Wolbachia like the previous one, but the +arthropod control still did not show any bands present. Confidence will increase as more testing is done.

Wolbachia 16S sequence
Arthropod COI sequence Download AB1
AAATTTATAACTCTATAGTTACAAGGCATGCATTTGTTATAATTTTCTTCATAGTTATACCTTTCATAATTGGTGGATTTGGTAATTTTCTTGTACCTTTAATATTAGGTTCACCTGATATGGCTTACCCCCGTATAAATAATATAAGATTTTGACTTTTACCCCCCTCTATTTCTCTTCTCCTTTTAAGAAATTTCATTAATGATGGAGTCGGAACAGGATGAACCATTTATCCTCCTTTAGCCTCAAACATCTTCCATAATGGCCCTTCAGTTGATTTAACTATTTTCTCTCTTCACATCGCTGGAATATCTTCTATTCTAGGGGCTATTAATTTTATTTCAACTATCATAAACATACACCATAAAAATTTTTCTATTGATAAAATTCCACTACTTGTATGATCAATCTTAATTACTGCAATTTTACTACTTCTATCCCTTCCTGTTCTTGCAGGAGCTATTACTATACTTTTAACTGACCGTAACCTTAATACTTCATTTTTTGACCCATCAGGAGGTGGTGATCCTATTTTATATCAACATCTTTTCTGA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Lasius alienus was found to be negative for Wolbachia.
Report Inappropriate Post