Owlet Moth

Sample information

Picture
Entry by: Arianna B
Location
Approximate location: 42.45, -73.27
Collection date 09/26/2025
Captive / Cultivated? Wild-caught
Group Berkshire Community College
Observations

The moth was still for over 24 hours on my outdoor screen door. thinking it was dead. I put it into my tube and it began to fly around aggressively

Putative identification Arthropoda Insecta Lepidoptera Noctuidae Papaipema Papaipema inquaesita

Methods

Extraction kit Monarch DNA extraction (NEB)
DNA extraction location Abdomen
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system Edvotek Gel Electrophoresis
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes

We used a DNA extraction protocol based on the insect adaptation of New England Biolabs’ Monarch Spin gDNA Extraction kit (Product # T3010)

The specimen was incubated for 30 minutes in a hot water bath at 56 degrees C.

Our second Gel image was taken on 11/4/25 and was run at 125 volts for 25 minutes

used this DNA ladder: New Englands Biolabs 1 kb Plus DNA Ladder for Safe Stains (product #N0559S)

 

On our second PCR reaction was set up on 10/28/25, used the same Taq polymerase as the first PCR reaction, and:

was a single reaction that used the Arthropod primers

used an annealing temperature of 49 degrees Celsius.

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

I am confident that my experimental results were valid. We followed protocol exactly and were very cautious about cross contamination. The bands look as they should- clear, bright, and the accurate size.

 

I am still confident that my results were valid. We used Arthropod CO1 primers for our single PCR and Wolbachia bands were clearly not present the first time we did Gel Electrophoresis and followed protocol exactly.

Wolbachia 16S sequence
Arthropod COI sequence Download AB1
CAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGACTTGTACCTTTAATATTAGGAGCTCCTGATATAGCATTTCCACGAATAAATAATATAAGTTTTTGATTACTTCCACCCTCATTAACTTTATTAATCTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGCTCATGGAGGAAGTTCTGTAGATTTAGCAATTTTTTCCCTTCATTTAGCTGGTATTTCCTCCATCTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGACTAAATAATTTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTAGGTATTACTGCATTTTTATTATTACTATCATTACCTGTTTTAGCAGGAGCTATCACAATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCAGCAGGAGGAGGAGACCCAATTTTATACCAACATTTATTTTGAT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Papaipema inquaesita was found to be negative for Wolbachia.
Report Inappropriate Post