Centipede

Sample information

Picture
Entry by: Noah RIcker
Location
Collection date 09/29/2025
Captive / Cultivated? Wild-caught
Group Berkshire Community College
Observations
  • The specimen been caught under a 5 foot long rock, under moist dirt in a garden flower.  Only odd thing that there was two stone centipedes that were around 8 inches near each other.
Putative identification Arthropoda Chilopoda Lithobiomorpha Lithobiidae Lithobius Lithobius forficatus

Methods

Extraction kit Monarch DNA extraction (NEB)
DNA extraction location Abdomen
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system Edvotek Gel Electrophoresis
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

We used the DNA extraction protocol based on insect adaptation of new england’s biolabs monarch spin gDNA Extraction kit. (Product # T3010) Specimen was incubated for 15 minutes in a hot water bath at 56 degrees C.

First pcr was done on oct 14th 2025 and was a duplex reaction since both arthropod CO1 and wolbachia 165 prime together. Annealing temperature at 49 degrees Celsius. Used Taq polymerase new england biolabs hot start quick-load 2x master with standard buffer (M0488S) Our first gel was taken on 10/21/2025 and ran at 100   Volts for 25 minutes and Used DNA ladder:new england biolabs 1kb plus DNA ladder for safe stains (product # No559s)

Our third  PCR was a single  PCR that only had Woolbachia primers using the same equipment. Our third  gel image was taken on 11/4 was run at 125 volts for 25 minutes used DNA ladder: new england biolab 1kb plus DNA ladder safe for stains (product # No559s) 

Results

Wolbachia presence No
Confidence level Medium
Explanation of confidence level

My current confidence level is at a medium for the two uncontaminated Duplex PCR showed zero Infected wolbachia inside the centipede. But It isnt a full 100 percent for because my single PCR for wolbachia failed due to a contamination. For full  condifence  a successfully  doing a single Wolbachia PCR would help solidy that there isnt any Wolbachia DNA whatsoever.

Wolbachia 16S sequence
Arthropod COI sequence Download AB1
GATCAGCAATAATTGGGACTGGCCTTAGCCTTCTTATTCGGTTAGAGTTAAGACAGCCTGGAAGATTAATTGGAGATGATCAAATTTATAATGTCATTGTTACCGCTCACGCCTTCATTATAATTTTTTTTATAGTTATACCAATCATAATTGGGGGATTCGGAAATTGACTTGTACCCTTAATATTAGGGGCCCCAGACATAGCATTTCCTCGAATAAATAACATAAGATTTTGATTACTCCCACCCTCCCTAACTCTCTTACTGTGTTCAGCAGCAGTAGAAAGAGGGGCAGGAACGGGGTGAACCGTTTACCCTCCCTTATCTTCTAATATTTCTCATAGAGGAGCATCAGTTGATATAACAATCTTTTCCCTACATCTCGCCGGAGCATCATCAATCCTGGGAGCAATCAACTTTATCTCCACTATTATTAATATACGGACTAGAGGAATGTCATTTGAACGAGTCCCCCTATTTGTGTGATCCGTAAAAATTACAGTTATCTTGCTCCTCCTTTCTCTTCCAGTATTAGCCGGAGCAATTACAATATTATTAACTGACCGAAACTTAAATACTAGCTTCTTCGACCCTACAGGAGGGGGAGACCCCATTTTATACCAACATTTATTTTGA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Lithobius forficatus was found to be negative for Wolbachia.
Report Inappropriate Post