German Yellowjacket

Sample information

Picture
Entry by: Isabella B
Location
Collection date 09/28/2025
Captive / Cultivated? Wild-caught
Group Berkshire Community College
Observations

Was found flying near the hive that is within the walls of a house but was collected while it was outdoors. Was not entering hive but flying and landing above the hive on the wall. Moving in an active and energetic way.

Putative identification Arthropoda Insecta Hymenoptera Vespidae Vespula Vespula germanica

Methods

Extraction kit Monarch DNA extraction (NEB)
DNA extraction location Abdomen
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system Edvotek Gel Electrophoresis
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes

We used DNA extraction protocol based on the insect adaptation of New England Biolabs’ Monarch Spin gDNA Extraction Kit (Product #T3010).

The specimen was incubated for 33 minutes in a hot water bath at 56 degrees C.

Details that differed from the written protocol are I forgot to dump the buffer solution at the bottom of the tube before I put the second wash buffer but I dumped it all out after pouring the second wash buffer in and before centrifuging.

Our first PCR reaction was set up on October 14 2025 and:

  1. was a duplex reaction because we used both the Arthropod CO1 and Wolbachia 16S primers together
  2. used this Taq polymerase: New England Biolabs Onetaq Hot Start Quick-Load 2x Master Mix with Standard Buffer (#M0488S)

Our first gel image was taken on 10/21/25 and:

  • was run at 125 volts for 20 minutes
  • used this DNA ladder: New England Biolabs 1kb Plus DNA Ladder for Safe Stains (product #N0559S)

Our second PCR reaction was set up on October 28th, used the same Taq polyamerase as the first PCR reaction, and:

  • was a duplex reaction that used arthropod F and R and Wolbachia R and F primers.
  •  used an annealing temperature of 49 degress Celsius.
  • differed from the standard protocol in that: I used 1.5 uL of positive DNA control with .5 uL of water since we had a smear last time.

Our second gel image was taken on 11/13/25 and:

  • was run at 125 volts for 21 mins
  • used this DNA ladder: New England Biolabs 1kb Plus DNA ladder for Safe Stains

Results

Wolbachia presence No
Confidence level Medium
Explanation of confidence level

In the first PCR the positive arthropod control didn’t show both bands and sample 1 didn’t show any arthropod DNA but showed Wolbachia which means there was a mistake made with the sample. Also the positive DNA control didn’t show any clear bands and showed up as a smear.

In the second PCR the controls all work as they should’ve and there was no signs on contamination so my confidence level is moderate. The sample was negative for Wolbachia especially with this duplex proving again it is negative.

Wolbachia 16S sequence
Arthropod COI sequence Download AB1
TGAGCAGGAACTTTAGGAGCTTCAATAAGAATAATTATTCGTTTAGAATTAAGATCCCCTGGAGCTTTAATTAATAATGATCAAATTTATAATACTATTATTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTTATACCTTTTTTAGTTGGAGGATTTGGAAATTGATTAATCCCTTTAATATTAGGTGTTCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCATCCTTATTTTTATTAATCTTAAGAAATTTTATTGGAACCGGAGTAGGGACAGGATGAACTCTGTACCCTCCTTTATCATCAATTGTAGGACATGACTCTCCCTCTGTAGACTTAGGAATTTTTTCTATCCATATTGCTGGAATTTCATCAATTATAGGTTCAATTAATTTTATTGTTACTATTTTAAATATACACACAAAAACACATTCACTAAATTTTCTTCCTTTATTTTCATGATCAATTTTAATTACAGCAATTCTTCTCTTGTTATCTCTACCAGTTCTTGCAGGAGCAATTACTATACTTCTTACAGACCGTAATTTAAATACATCTTTCTTTGATCCTGCAGGCGGAGGTGACCCAATTTTATACCAACATTTA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Vespula germanica was found to be negative for Wolbachia.
Report Inappropriate Post