Ant Found in Pittsfield

Sample information

Picture
Entry by: Samara C.
Location
Approximate location: 42.45, -73.25
Collection date 09/29/2025
Captive / Cultivated? Wild-caught
Group Berkshire Community College
Observations
  • Next to a garden
  • Outside open area
  • Crawling out from underground
Putative identification Arthropoda Insecta Hymenoptera Formicidae Lasius Lasius neoniger

Methods

Extraction kit Monarch DNA extraction (NEB)
DNA extraction location Whole arthropod
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system Edvotek Gel Electrophoresis
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes

1. We used a DNA extraction protocol based on the insect adaptation of New England Biolabs’ Monarch Spin gDNA Extraction kit (Product #T3010)

2. The specimen was incubated for 30 minutes in a hot water bath at 56 degrees C.

3. Our first PCR reaction was set up on October 14th,2025 and was a duplex reaction because we used both the Arthropod CO1 and Wolbachia 16s primers together

4. used an annealing temperature of 49 degrees Celsius

5. used this Taq polymerase: New England Biolabs OneTaq Hot Start Quick-Load 2X Master Mix with Standard Buffer (#M0488S)

6. differed from the written protocol (time differences, accidental mistakes, etc.)

7. Our first Gel Image was taken on 10/21/25 – was run at 125 volts for 20 minutes

– used this DNA ladder: New England Biolabs 1kb Plus DNA Ladder for Safe Stains (product #N0559S)

  • Our second PCR reaction was set up on Oct. 28, 2025, used the same Taq polymerase as the first PCR reaction, and:
  • was a dublex reaction that used the arthropod F and R and Wolbachia R and F primers.
  • used an annealing temperature of 49 degrees Celsius
  • differed from the standard protocol (differences in amount of DNA per sample, accidental mistakes, etc.) in that: – used 1.5 UL of (+) DNA control with .5 UL

Results

Wolbachia presence No
Confidence level Medium
Explanation of confidence level
Wolbachia 16S sequence
Arthropod COI sequence Download AB1
TTTGAGCTGGTATAATCGGTTCATCTATAAGAATAATTATTCGTCTAGAATTAGGATCATCTAATTCATTGATTAACAATGATCAAATTTATAATTCTATAGTTACAAGACATGCATTCATTATAATTTTCTTTATAGTTATGCCTTTCATAATTGGAGGATTTGGAAATTTCCTTGTACCTTTAATATTAGGCTCACCTGATATAGCTTATCCACGTATAAACAATATGAGATTTTGACTTTTACCCCCCTCAATTTCTCTTCTTATTTTAAGAAATTTTATTAATGATGGTGTTGGGACAGGATGAACTGTTTATCCTCCTTTAGCTTCAAATATTTTCCATAATGGACCTTCAGTTGATTTAACTATTTTTTCCCTCCATATTGCGGGTATATCTTCAATTTTAGGAGCTATTAATTTTATTTCAACTATCTTAAATATACATCACAAAAATTTTTCTATCGATAAAATCCCTTTACTTGTATGATCAATTTTAATTACTGCAATTTTACTTCTCTTATCCTTACCCGTTCTTGCAGGAGCTATTACTATACTTTTAACTGACCGTAATCTTAACACTTCATTTTTTGATCCATCAGGTGGTGGAGATCCTATTTTATATCAACATCTTTTTTGA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Lasius neoniger was found to be negative for Wolbachia.
Report Inappropriate Post